ID: 1057298193

View in Genome Browser
Species Human (GRCh38)
Location 9:93861349-93861371
Sequence AGAGCCCCAGGCACTTTCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298193_1057298201 12 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298201 9:93861384-93861406 AGAGACCGCGTGCGGCCTGGGGG No data
1057298193_1057298198 9 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298198 9:93861381-93861403 TCAAGAGACCGCGTGCGGCCTGG No data
1057298193_1057298200 11 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298200 9:93861383-93861405 AAGAGACCGCGTGCGGCCTGGGG No data
1057298193_1057298204 23 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298204 9:93861395-93861417 GCGGCCTGGGGGCCTGGCTCTGG No data
1057298193_1057298205 24 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298205 9:93861396-93861418 CGGCCTGGGGGCCTGGCTCTGGG No data
1057298193_1057298197 4 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298197 9:93861376-93861398 GGCTCTCAAGAGACCGCGTGCGG No data
1057298193_1057298207 26 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298207 9:93861398-93861420 GCCTGGGGGCCTGGCTCTGGGGG No data
1057298193_1057298199 10 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298199 9:93861382-93861404 CAAGAGACCGCGTGCGGCCTGGG No data
1057298193_1057298203 17 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298203 9:93861389-93861411 CCGCGTGCGGCCTGGGGGCCTGG No data
1057298193_1057298206 25 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298206 9:93861397-93861419 GGCCTGGGGGCCTGGCTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298193 Original CRISPR AGAGCCCCAGGCACTTTCCG CGG (reversed) Intergenic
No off target data available for this crispr