ID: 1057298196

View in Genome Browser
Species Human (GRCh38)
Location 9:93861361-93861383
Sequence TGAGAGCCCTGCAGAGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298196_1057298205 12 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298205 9:93861396-93861418 CGGCCTGGGGGCCTGGCTCTGGG No data
1057298196_1057298200 -1 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298200 9:93861383-93861405 AAGAGACCGCGTGCGGCCTGGGG No data
1057298196_1057298211 26 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298211 9:93861410-93861432 GGCTCTGGGGGCTGCCATCCGGG No data
1057298196_1057298210 25 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298210 9:93861409-93861431 TGGCTCTGGGGGCTGCCATCCGG No data
1057298196_1057298206 13 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298206 9:93861397-93861419 GGCCTGGGGGCCTGGCTCTGGGG No data
1057298196_1057298204 11 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298204 9:93861395-93861417 GCGGCCTGGGGGCCTGGCTCTGG No data
1057298196_1057298207 14 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298207 9:93861398-93861420 GCCTGGGGGCCTGGCTCTGGGGG No data
1057298196_1057298199 -2 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298199 9:93861382-93861404 CAAGAGACCGCGTGCGGCCTGGG No data
1057298196_1057298198 -3 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298198 9:93861381-93861403 TCAAGAGACCGCGTGCGGCCTGG No data
1057298196_1057298197 -8 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298197 9:93861376-93861398 GGCTCTCAAGAGACCGCGTGCGG No data
1057298196_1057298203 5 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298203 9:93861389-93861411 CCGCGTGCGGCCTGGGGGCCTGG No data
1057298196_1057298201 0 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298201 9:93861384-93861406 AGAGACCGCGTGCGGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298196 Original CRISPR TGAGAGCCCTGCAGAGCCCC AGG (reversed) Intergenic
No off target data available for this crispr