ID: 1057298205

View in Genome Browser
Species Human (GRCh38)
Location 9:93861396-93861418
Sequence CGGCCTGGGGGCCTGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298192_1057298205 25 Left 1057298192 9:93861348-93861370 CCCGCGGAAAGTGCCTGGGGCTC No data
Right 1057298205 9:93861396-93861418 CGGCCTGGGGGCCTGGCTCTGGG No data
1057298196_1057298205 12 Left 1057298196 9:93861361-93861383 CCTGGGGCTCTGCAGGGCTCTCA No data
Right 1057298205 9:93861396-93861418 CGGCCTGGGGGCCTGGCTCTGGG No data
1057298193_1057298205 24 Left 1057298193 9:93861349-93861371 CCGCGGAAAGTGCCTGGGGCTCT No data
Right 1057298205 9:93861396-93861418 CGGCCTGGGGGCCTGGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298205 Original CRISPR CGGCCTGGGGGCCTGGCTCT GGG Intergenic
No off target data available for this crispr