ID: 1057298458

View in Genome Browser
Species Human (GRCh38)
Location 9:93862684-93862706
Sequence CCACCGGAAAGAACCAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298458_1057298464 14 Left 1057298458 9:93862684-93862706 CCAGAGTTGGTTCTTTCCGGTGG No data
Right 1057298464 9:93862721-93862743 TGACTTCAAGAATGAAGCCACGG No data
1057298458_1057298465 24 Left 1057298458 9:93862684-93862706 CCAGAGTTGGTTCTTTCCGGTGG No data
Right 1057298465 9:93862731-93862753 AATGAAGCCACGGATCTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298458 Original CRISPR CCACCGGAAAGAACCAACTC TGG (reversed) Intergenic