ID: 1057298462

View in Genome Browser
Species Human (GRCh38)
Location 9:93862700-93862722
Sequence CAGCGAGACCAAGGACCCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298462_1057298464 -2 Left 1057298462 9:93862700-93862722 CCGGTGGGTCCTTGGTCTCGCTG No data
Right 1057298464 9:93862721-93862743 TGACTTCAAGAATGAAGCCACGG 0: 419
1: 1250
2: 904
3: 365
4: 360
1057298462_1057298468 29 Left 1057298462 9:93862700-93862722 CCGGTGGGTCCTTGGTCTCGCTG No data
Right 1057298468 9:93862752-93862774 GGTGTTACAGCTTTTAAAGGTGG No data
1057298462_1057298465 8 Left 1057298462 9:93862700-93862722 CCGGTGGGTCCTTGGTCTCGCTG No data
Right 1057298465 9:93862731-93862753 AATGAAGCCACGGATCTTCGCGG No data
1057298462_1057298467 26 Left 1057298462 9:93862700-93862722 CCGGTGGGTCCTTGGTCTCGCTG No data
Right 1057298467 9:93862749-93862771 CGCGGTGTTACAGCTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298462 Original CRISPR CAGCGAGACCAAGGACCCAC CGG (reversed) Intergenic
No off target data available for this crispr