ID: 1057298463

View in Genome Browser
Species Human (GRCh38)
Location 9:93862709-93862731
Sequence TCTTGAAGTCAGCGAGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298463_1057298469 25 Left 1057298463 9:93862709-93862731 CCTTGGTCTCGCTGACTTCAAGA No data
Right 1057298469 9:93862757-93862779 TACAGCTTTTAAAGGTGGCACGG No data
1057298463_1057298467 17 Left 1057298463 9:93862709-93862731 CCTTGGTCTCGCTGACTTCAAGA No data
Right 1057298467 9:93862749-93862771 CGCGGTGTTACAGCTTTTAAAGG No data
1057298463_1057298465 -1 Left 1057298463 9:93862709-93862731 CCTTGGTCTCGCTGACTTCAAGA No data
Right 1057298465 9:93862731-93862753 AATGAAGCCACGGATCTTCGCGG No data
1057298463_1057298468 20 Left 1057298463 9:93862709-93862731 CCTTGGTCTCGCTGACTTCAAGA No data
Right 1057298468 9:93862752-93862774 GGTGTTACAGCTTTTAAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298463 Original CRISPR TCTTGAAGTCAGCGAGACCA AGG (reversed) Intergenic