ID: 1057298465

View in Genome Browser
Species Human (GRCh38)
Location 9:93862731-93862753
Sequence AATGAAGCCACGGATCTTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298462_1057298465 8 Left 1057298462 9:93862700-93862722 CCGGTGGGTCCTTGGTCTCGCTG No data
Right 1057298465 9:93862731-93862753 AATGAAGCCACGGATCTTCGCGG No data
1057298458_1057298465 24 Left 1057298458 9:93862684-93862706 CCAGAGTTGGTTCTTTCCGGTGG No data
Right 1057298465 9:93862731-93862753 AATGAAGCCACGGATCTTCGCGG No data
1057298463_1057298465 -1 Left 1057298463 9:93862709-93862731 CCTTGGTCTCGCTGACTTCAAGA No data
Right 1057298465 9:93862731-93862753 AATGAAGCCACGGATCTTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298465 Original CRISPR AATGAAGCCACGGATCTTCG CGG Intergenic