ID: 1057298467

View in Genome Browser
Species Human (GRCh38)
Location 9:93862749-93862771
Sequence CGCGGTGTTACAGCTTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298463_1057298467 17 Left 1057298463 9:93862709-93862731 CCTTGGTCTCGCTGACTTCAAGA No data
Right 1057298467 9:93862749-93862771 CGCGGTGTTACAGCTTTTAAAGG No data
1057298462_1057298467 26 Left 1057298462 9:93862700-93862722 CCGGTGGGTCCTTGGTCTCGCTG No data
Right 1057298467 9:93862749-93862771 CGCGGTGTTACAGCTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298467 Original CRISPR CGCGGTGTTACAGCTTTTAA AGG Intergenic
No off target data available for this crispr