ID: 1057298469

View in Genome Browser
Species Human (GRCh38)
Location 9:93862757-93862779
Sequence TACAGCTTTTAAAGGTGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057298463_1057298469 25 Left 1057298463 9:93862709-93862731 CCTTGGTCTCGCTGACTTCAAGA No data
Right 1057298469 9:93862757-93862779 TACAGCTTTTAAAGGTGGCACGG No data
1057298466_1057298469 -4 Left 1057298466 9:93862738-93862760 CCACGGATCTTCGCGGTGTTACA No data
Right 1057298469 9:93862757-93862779 TACAGCTTTTAAAGGTGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057298469 Original CRISPR TACAGCTTTTAAAGGTGGCA CGG Intergenic