ID: 1057299725

View in Genome Browser
Species Human (GRCh38)
Location 9:93870826-93870848
Sequence TGTAGAATCCTCTAGTTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057299725_1057299728 -8 Left 1057299725 9:93870826-93870848 CCCTGGAACTAGAGGATTCTACA No data
Right 1057299728 9:93870841-93870863 ATTCTACACTTTCCTCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057299725 Original CRISPR TGTAGAATCCTCTAGTTCCA GGG (reversed) Intergenic
No off target data available for this crispr