ID: 1057300413

View in Genome Browser
Species Human (GRCh38)
Location 9:93875997-93876019
Sequence TGCCCTGCAAAAGTACAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057300412_1057300413 18 Left 1057300412 9:93875956-93875978 CCAGATAAACAAAAGCTGAGGGA 0: 41
1: 393
2: 786
3: 1256
4: 1452
Right 1057300413 9:93875997-93876019 TGCCCTGCAAAAGTACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057300413 Original CRISPR TGCCCTGCAAAAGTACAAAA AGG Intergenic
No off target data available for this crispr