ID: 1057303439

View in Genome Browser
Species Human (GRCh38)
Location 9:93899474-93899496
Sequence CTCTGTATGAGGAGGGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057303439_1057303448 27 Left 1057303439 9:93899474-93899496 CCAGCTCCCCTCCTCATACAGAG No data
Right 1057303448 9:93899524-93899546 TCCCCACTTGTTCACCCCTCAGG No data
1057303439_1057303450 28 Left 1057303439 9:93899474-93899496 CCAGCTCCCCTCCTCATACAGAG No data
Right 1057303450 9:93899525-93899547 CCCCACTTGTTCACCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057303439 Original CRISPR CTCTGTATGAGGAGGGGAGC TGG (reversed) Intergenic
No off target data available for this crispr