ID: 1057303475

View in Genome Browser
Species Human (GRCh38)
Location 9:93899617-93899639
Sequence TGGGAGACTGAGATGTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057303475_1057303480 11 Left 1057303475 9:93899617-93899639 CCTCTCCACATCTCAGTCTCCCA No data
Right 1057303480 9:93899651-93899673 AGTCTGGTAGCGCCTTTCACAGG No data
1057303475_1057303482 13 Left 1057303475 9:93899617-93899639 CCTCTCCACATCTCAGTCTCCCA No data
Right 1057303482 9:93899653-93899675 TCTGGTAGCGCCTTTCACAGGGG No data
1057303475_1057303477 -5 Left 1057303475 9:93899617-93899639 CCTCTCCACATCTCAGTCTCCCA No data
Right 1057303477 9:93899635-93899657 TCCCAGTTTGCAAAACAGTCTGG No data
1057303475_1057303481 12 Left 1057303475 9:93899617-93899639 CCTCTCCACATCTCAGTCTCCCA No data
Right 1057303481 9:93899652-93899674 GTCTGGTAGCGCCTTTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057303475 Original CRISPR TGGGAGACTGAGATGTGGAG AGG (reversed) Intergenic
No off target data available for this crispr