ID: 1057303599

View in Genome Browser
Species Human (GRCh38)
Location 9:93900121-93900143
Sequence ACTTTGTCCTGGGGGTACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057303599_1057303607 -4 Left 1057303599 9:93900121-93900143 CCCTAGTACCCCCAGGACAAAGT No data
Right 1057303607 9:93900140-93900162 AAGTCACCCAGGGCCCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057303599 Original CRISPR ACTTTGTCCTGGGGGTACTA GGG (reversed) Intergenic
No off target data available for this crispr