ID: 1057304320

View in Genome Browser
Species Human (GRCh38)
Location 9:93903544-93903566
Sequence TGGGCTCCACACTCCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057304320_1057304326 3 Left 1057304320 9:93903544-93903566 CCAAGATGGGAGTGTGGAGCCCA No data
Right 1057304326 9:93903570-93903592 CAGGAGCTGGGCCCCTCCTCAGG No data
1057304320_1057304322 -10 Left 1057304320 9:93903544-93903566 CCAAGATGGGAGTGTGGAGCCCA No data
Right 1057304322 9:93903557-93903579 GTGGAGCCCACAGCAGGAGCTGG No data
1057304320_1057304323 -9 Left 1057304320 9:93903544-93903566 CCAAGATGGGAGTGTGGAGCCCA No data
Right 1057304323 9:93903558-93903580 TGGAGCCCACAGCAGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057304320 Original CRISPR TGGGCTCCACACTCCCATCT TGG (reversed) Intergenic
No off target data available for this crispr