ID: 1057305855

View in Genome Browser
Species Human (GRCh38)
Location 9:93911522-93911544
Sequence GCCCGTCCACCTGTGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057305855_1057305859 -9 Left 1057305855 9:93911522-93911544 CCCGCGCCCACAGGTGGACGGGC No data
Right 1057305859 9:93911536-93911558 TGGACGGGCACTCACCGAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057305855 Original CRISPR GCCCGTCCACCTGTGGGCGC GGG (reversed) Intergenic