ID: 1057307720

View in Genome Browser
Species Human (GRCh38)
Location 9:93921779-93921801
Sequence CCCTGAGAGGCTGCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057307720_1057307730 4 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307730 9:93921806-93921828 CAACAAGGGCAGAGCCCACGTGG No data
1057307720_1057307733 12 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307733 9:93921814-93921836 GCAGAGCCCACGTGGGAGGATGG No data
1057307720_1057307736 17 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307736 9:93921819-93921841 GCCCACGTGGGAGGATGGAGGGG No data
1057307720_1057307732 8 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307732 9:93921810-93921832 AAGGGCAGAGCCCACGTGGGAGG No data
1057307720_1057307727 -10 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307727 9:93921792-93921814 CCTCTCAGGGAGCCCAACAAGGG No data
1057307720_1057307735 16 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307735 9:93921818-93921840 AGCCCACGTGGGAGGATGGAGGG No data
1057307720_1057307734 15 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307734 9:93921817-93921839 GAGCCCACGTGGGAGGATGGAGG No data
1057307720_1057307731 5 Left 1057307720 9:93921779-93921801 CCAGCCCCGGCAGCCTCTCAGGG No data
Right 1057307731 9:93921807-93921829 AACAAGGGCAGAGCCCACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057307720 Original CRISPR CCCTGAGAGGCTGCCGGGGC TGG (reversed) Intergenic
No off target data available for this crispr