ID: 1057310501

View in Genome Browser
Species Human (GRCh38)
Location 9:93940158-93940180
Sequence CCCCTACGATGTAGTCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057310499_1057310501 -8 Left 1057310499 9:93940143-93940165 CCAGACACAATGGGACCCCTACG No data
Right 1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG No data
1057310491_1057310501 24 Left 1057310491 9:93940111-93940133 CCATACCACAAACCCACTGGAAG No data
Right 1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG No data
1057310495_1057310501 11 Left 1057310495 9:93940124-93940146 CCACTGGAAGGAACCAGCTCCAG 0: 2
1: 21
2: 92
3: 292
4: 682
Right 1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG No data
1057310494_1057310501 12 Left 1057310494 9:93940123-93940145 CCCACTGGAAGGAACCAGCTCCA 0: 2
1: 23
2: 85
3: 272
4: 607
Right 1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG No data
1057310493_1057310501 19 Left 1057310493 9:93940116-93940138 CCACAAACCCACTGGAAGGAACC 0: 12
1: 42
2: 309
3: 713
4: 1597
Right 1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG No data
1057310498_1057310501 -2 Left 1057310498 9:93940137-93940159 CCAGCTCCAGACACAATGGGACC No data
Right 1057310501 9:93940158-93940180 CCCCTACGATGTAGTCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057310501 Original CRISPR CCCCTACGATGTAGTCCTGA AGG Intergenic
No off target data available for this crispr