ID: 1057310529

View in Genome Browser
Species Human (GRCh38)
Location 9:93940307-93940329
Sequence CTCAGACACACGGGCAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057310524_1057310529 -7 Left 1057310524 9:93940291-93940313 CCGTGCTGTCCACCAGCTCAGAC No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data
1057310517_1057310529 29 Left 1057310517 9:93940255-93940277 CCATGAGCATCCAGCCTGAGTCC No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data
1057310523_1057310529 0 Left 1057310523 9:93940284-93940306 CCATTTTCCGTGCTGTCCACCAG No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data
1057310519_1057310529 15 Left 1057310519 9:93940269-93940291 CCTGAGTCCTCCCTTCCATTTTC No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data
1057310522_1057310529 4 Left 1057310522 9:93940280-93940302 CCTTCCATTTTCCGTGCTGTCCA No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data
1057310520_1057310529 8 Left 1057310520 9:93940276-93940298 CCTCCCTTCCATTTTCCGTGCTG No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data
1057310521_1057310529 5 Left 1057310521 9:93940279-93940301 CCCTTCCATTTTCCGTGCTGTCC No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data
1057310518_1057310529 19 Left 1057310518 9:93940265-93940287 CCAGCCTGAGTCCTCCCTTCCAT No data
Right 1057310529 9:93940307-93940329 CTCAGACACACGGGCAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057310529 Original CRISPR CTCAGACACACGGGCAGAGA TGG Intergenic
No off target data available for this crispr