ID: 1057310780

View in Genome Browser
Species Human (GRCh38)
Location 9:93941772-93941794
Sequence AGTCCAGTGAGAGAACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057310775_1057310780 23 Left 1057310775 9:93941726-93941748 CCAGCCCCAGAGTAGGCTCACTG No data
Right 1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG No data
1057310774_1057310780 26 Left 1057310774 9:93941723-93941745 CCTCCAGCCCCAGAGTAGGCTCA No data
Right 1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG No data
1057310776_1057310780 19 Left 1057310776 9:93941730-93941752 CCCCAGAGTAGGCTCACTGTGCA No data
Right 1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG No data
1057310771_1057310780 30 Left 1057310771 9:93941719-93941741 CCCTCCTCCAGCCCCAGAGTAGG No data
Right 1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG No data
1057310778_1057310780 17 Left 1057310778 9:93941732-93941754 CCAGAGTAGGCTCACTGTGCACT No data
Right 1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG No data
1057310773_1057310780 29 Left 1057310773 9:93941720-93941742 CCTCCTCCAGCCCCAGAGTAGGC No data
Right 1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG No data
1057310777_1057310780 18 Left 1057310777 9:93941731-93941753 CCCAGAGTAGGCTCACTGTGCAC No data
Right 1057310780 9:93941772-93941794 AGTCCAGTGAGAGAACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057310780 Original CRISPR AGTCCAGTGAGAGAACACAC AGG Intergenic
No off target data available for this crispr