ID: 1057310785

View in Genome Browser
Species Human (GRCh38)
Location 9:93941797-93941819
Sequence CCCAACAGGTTACATGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057310781_1057310785 -1 Left 1057310781 9:93941775-93941797 CCAGTGAGAGAACACACAGGCAC No data
Right 1057310785 9:93941797-93941819 CCCAACAGGTTACATGAAGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057310785 Original CRISPR CCCAACAGGTTACATGAAGC GGG Intergenic
No off target data available for this crispr