ID: 1057311492

View in Genome Browser
Species Human (GRCh38)
Location 9:93945946-93945968
Sequence CCTCGCTAATGCGTTTCGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057311488_1057311492 0 Left 1057311488 9:93945923-93945945 CCGCCTGCCATGCGCAGCACGAG No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311482_1057311492 25 Left 1057311482 9:93945898-93945920 CCACCTGCCCCTTGCACGGGCGG No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311490_1057311492 -7 Left 1057311490 9:93945930-93945952 CCATGCGCAGCACGAGCCTCGCT No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311485_1057311492 18 Left 1057311485 9:93945905-93945927 CCCCTTGCACGGGCGGCGCCGCC No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311484_1057311492 22 Left 1057311484 9:93945901-93945923 CCTGCCCCTTGCACGGGCGGCGC No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311487_1057311492 16 Left 1057311487 9:93945907-93945929 CCTTGCACGGGCGGCGCCGCCTG No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311486_1057311492 17 Left 1057311486 9:93945906-93945928 CCCTTGCACGGGCGGCGCCGCCT No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311489_1057311492 -3 Left 1057311489 9:93945926-93945948 CCTGCCATGCGCAGCACGAGCCT No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data
1057311480_1057311492 28 Left 1057311480 9:93945895-93945917 CCTCCACCTGCCCCTTGCACGGG No data
Right 1057311492 9:93945946-93945968 CCTCGCTAATGCGTTTCGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057311492 Original CRISPR CCTCGCTAATGCGTTTCGCA TGG Intergenic