ID: 1057311497

View in Genome Browser
Species Human (GRCh38)
Location 9:93946021-93946043
Sequence TTTTTTTCTCCTTTTTCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057311497_1057311505 13 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311505 9:93946057-93946079 TGGAAGCGGAGCTGCCGCGGGGG No data
1057311497_1057311504 12 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311504 9:93946056-93946078 GTGGAAGCGGAGCTGCCGCGGGG No data
1057311497_1057311506 17 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311506 9:93946061-93946083 AGCGGAGCTGCCGCGGGGGCTGG No data
1057311497_1057311503 11 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311503 9:93946055-93946077 GGTGGAAGCGGAGCTGCCGCGGG No data
1057311497_1057311507 18 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311507 9:93946062-93946084 GCGGAGCTGCCGCGGGGGCTGGG No data
1057311497_1057311502 10 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311502 9:93946054-93946076 TGGTGGAAGCGGAGCTGCCGCGG No data
1057311497_1057311500 -1 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311500 9:93946043-93946065 AGCAAATTGCCTGGTGGAAGCGG No data
1057311497_1057311499 -7 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311499 9:93946037-93946059 AAAAAAAGCAAATTGCCTGGTGG No data
1057311497_1057311508 19 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311508 9:93946063-93946085 CGGAGCTGCCGCGGGGGCTGGGG No data
1057311497_1057311509 22 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311509 9:93946066-93946088 AGCTGCCGCGGGGGCTGGGGCGG No data
1057311497_1057311498 -10 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311498 9:93946034-93946056 GAGAAAAAAAGCAAATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057311497 Original CRISPR TTTTTTTCTCCTTTTTCATA AGG (reversed) Intergenic
No off target data available for this crispr