ID: 1057311508

View in Genome Browser
Species Human (GRCh38)
Location 9:93946063-93946085
Sequence CGGAGCTGCCGCGGGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057311497_1057311508 19 Left 1057311497 9:93946021-93946043 CCTTATGAAAAAGGAGAAAAAAA No data
Right 1057311508 9:93946063-93946085 CGGAGCTGCCGCGGGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057311508 Original CRISPR CGGAGCTGCCGCGGGGGCTG GGG Intergenic
No off target data available for this crispr