ID: 1057311510

View in Genome Browser
Species Human (GRCh38)
Location 9:93946071-93946093
Sequence CGCTGCCGCCCCAGCCCCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057311510_1057311518 14 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311518 9:93946108-93946130 TGCGTTCGGCAGGGCGGACTTGG No data
1057311510_1057311522 27 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311522 9:93946121-93946143 GCGGACTTGGGGCGGCTGTCAGG No data
1057311510_1057311521 19 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311521 9:93946113-93946135 TCGGCAGGGCGGACTTGGGGCGG No data
1057311510_1057311516 5 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311516 9:93946099-93946121 GGGCGGAGTTGCGTTCGGCAGGG No data
1057311510_1057311520 16 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311520 9:93946110-93946132 CGTTCGGCAGGGCGGACTTGGGG No data
1057311510_1057311517 8 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311517 9:93946102-93946124 CGGAGTTGCGTTCGGCAGGGCGG No data
1057311510_1057311524 29 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311524 9:93946123-93946145 GGACTTGGGGCGGCTGTCAGGGG No data
1057311510_1057311514 0 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311514 9:93946094-93946116 CGTGCGGGCGGAGTTGCGTTCGG No data
1057311510_1057311523 28 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311523 9:93946122-93946144 CGGACTTGGGGCGGCTGTCAGGG No data
1057311510_1057311519 15 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311519 9:93946109-93946131 GCGTTCGGCAGGGCGGACTTGGG No data
1057311510_1057311515 4 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311515 9:93946098-93946120 CGGGCGGAGTTGCGTTCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057311510 Original CRISPR CGCTGCCGCCCCAGCCCCCG CGG (reversed) Intergenic