ID: 1057311517

View in Genome Browser
Species Human (GRCh38)
Location 9:93946102-93946124
Sequence CGGAGTTGCGTTCGGCAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057311501_1057311517 27 Left 1057311501 9:93946052-93946074 CCTGGTGGAAGCGGAGCTGCCGC No data
Right 1057311517 9:93946102-93946124 CGGAGTTGCGTTCGGCAGGGCGG No data
1057311510_1057311517 8 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311517 9:93946102-93946124 CGGAGTTGCGTTCGGCAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057311517 Original CRISPR CGGAGTTGCGTTCGGCAGGG CGG Intergenic
No off target data available for this crispr