ID: 1057311524

View in Genome Browser
Species Human (GRCh38)
Location 9:93946123-93946145
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057311510_1057311524 29 Left 1057311510 9:93946071-93946093 CCGCGGGGGCTGGGGCGGCAGCG No data
Right 1057311524 9:93946123-93946145 GGACTTGGGGCGGCTGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057311524 Original CRISPR GGACTTGGGGCGGCTGTCAG GGG Intergenic