ID: 1057311912

View in Genome Browser
Species Human (GRCh38)
Location 9:93948264-93948286
Sequence GGGTTGAGAGGACCACATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057311905_1057311912 20 Left 1057311905 9:93948221-93948243 CCAGGGAGATGGGGAGAGATGGC No data
Right 1057311912 9:93948264-93948286 GGGTTGAGAGGACCACATTTTGG No data
1057311908_1057311912 -2 Left 1057311908 9:93948243-93948265 CCGAGTGAAGGTGCTCACTCGGG No data
Right 1057311912 9:93948264-93948286 GGGTTGAGAGGACCACATTTTGG No data
1057311902_1057311912 29 Left 1057311902 9:93948212-93948234 CCTGGAGCTCCAGGGAGATGGGG No data
Right 1057311912 9:93948264-93948286 GGGTTGAGAGGACCACATTTTGG No data
1057311900_1057311912 30 Left 1057311900 9:93948211-93948233 CCCTGGAGCTCCAGGGAGATGGG No data
Right 1057311912 9:93948264-93948286 GGGTTGAGAGGACCACATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057311912 Original CRISPR GGGTTGAGAGGACCACATTT TGG Intergenic
No off target data available for this crispr