ID: 1057312625

View in Genome Browser
Species Human (GRCh38)
Location 9:93951681-93951703
Sequence TAGGGGCCCCAGCGACATCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057312619_1057312625 -4 Left 1057312619 9:93951662-93951684 CCGTCTTCGCAAGAGGGGGTAGG 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057312625 Original CRISPR TAGGGGCCCCAGCGACATCG GGG Exonic
900154768 1:1199496-1199518 CAGGGGCCCCAGGGGCATCAGGG - Intergenic
904003452 1:27351114-27351136 TAGGGGTCCTAGCGCCCTCGGGG - Intronic
1066300588 10:34092111-34092133 AAGGGGCCCCAGAGACACTGGGG + Intergenic
1083678732 11:64341744-64341766 TAGGGGCAGCAGGGGCATCGTGG + Intronic
1084145720 11:67264219-67264241 TAGGGGCACCAGTGACAGTGGGG + Intergenic
1088993617 11:114976728-114976750 TAAGGGGCCCAGCCACATCTGGG + Intergenic
1110332609 13:74289951-74289973 TAGGGCCTCCAGCTACATCAAGG - Intergenic
1122891987 14:104736249-104736271 TAGGGGCTCCTGCGACATGGCGG - Intronic
1123061366 14:105596193-105596215 CTGGGGCCCCAGAGCCATCGGGG - Intergenic
1123085820 14:105717104-105717126 CTGGGGCCCCAGAGCCATCGGGG - Intergenic
1126172932 15:45709124-45709146 TAGAGCCCCCAGAGACATCCAGG + Intergenic
1134016922 16:10895297-10895319 TAGGGGCCCCAACTCCATGGTGG - Exonic
1141470808 16:84237122-84237144 CAGGAGCCCCAGCGCCTTCGGGG - Exonic
1142361893 16:89631242-89631264 CAGGTGCCCCAGCGAGGTCGGGG - Intronic
1145236842 17:21214318-21214340 TACGGGCCCCGGCGACCCCGGGG - Exonic
1147690597 17:42312506-42312528 CAAGGGCCCCAGCGACAGCAGGG - Intergenic
1152906577 17:82973840-82973862 TAGCAGCCCCAGCGCCATTGTGG - Intronic
1155497219 18:26454496-26454518 GAGGGGCCCAAGCCACATAGAGG + Intergenic
1157187539 18:45553298-45553320 TTGGGGCCACAGTGACATAGGGG - Intronic
1166837850 19:45678099-45678121 CAGGGGCACCAGCGTCAGCGTGG - Exonic
925180709 2:1815338-1815360 GAGGGACCCCAGCGACAGAGAGG - Intronic
935095006 2:99935864-99935886 CAGAGTCCCCAGCGACATGGAGG + Intronic
940211640 2:151261572-151261594 GAGGGGCCCCAGGGACCCCGGGG - Intronic
943528093 2:189043239-189043261 TAGGGACCCCAAGGACCTCGTGG - Exonic
1173663763 20:44751482-44751504 AAGTGGCCCCAGTGACATGGTGG - Exonic
949879216 3:8648703-8648725 GAGGGGCCTCAGCTACATCAAGG - Intronic
953243751 3:41172183-41172205 TAGGGGCCCCAGCACAGTCGGGG - Intergenic
954203098 3:49036939-49036961 TATGGCCCCCAGCTACATGGAGG + Intronic
954779176 3:53046355-53046377 TCGGGGCCACAGCGCCGTCGGGG - Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
971068293 4:23060121-23060143 TAGGGGCCTCAGTGTCATCTTGG - Intergenic
988665976 5:33328019-33328041 TAGGGGATCTAGCGCCATCGGGG - Intergenic
991183256 5:63778930-63778952 TAGGGGCCCCAGGGGCAAGGGGG + Intergenic
993498927 5:88641259-88641281 TAAGGGCTGCAGCGACATAGTGG - Intergenic
996241762 5:121212947-121212969 TAGTGGCCCCAGTGACACTGTGG + Intergenic
998769258 5:145523577-145523599 TAGGGGCCACAGAGAGATGGTGG - Intronic
1005918774 6:30379620-30379642 TAGGGGTCCCAGCAAAATGGAGG + Intergenic
1006558608 6:34889658-34889680 TTGGGTCCCCAGAGAGATCGGGG + Intronic
1018812620 6:167308607-167308629 TAGGGGCCCCAGCCCCAGCAAGG - Intronic
1019485054 7:1285572-1285594 GAGGGGCCCCAGGGACAACTGGG - Intergenic
1019518458 7:1449967-1449989 TAGGGTCCCCAGCCACCTCCTGG + Intronic
1037585413 8:20272503-20272525 TAGGGTCCCCATCGGCATCTGGG - Intronic
1051332633 9:16039267-16039289 TAGGGGCCTCAGCCACATGAGGG - Intronic
1057312625 9:93951681-93951703 TAGGGGCCCCAGCGACATCGGGG + Exonic
1060657232 9:125380482-125380504 TGGGGGACCCAGAGACATCCTGG - Intergenic