ID: 1057314604

View in Genome Browser
Species Human (GRCh38)
Location 9:93960387-93960409
Sequence TCTGCGGGAGCCGCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057314604_1057314614 22 Left 1057314604 9:93960387-93960409 CCAGCCCCGGCGGCTCCCGCAGA No data
Right 1057314614 9:93960432-93960454 ACGCGAACCAGCGGCGCCTGAGG No data
1057314604_1057314612 13 Left 1057314604 9:93960387-93960409 CCAGCCCCGGCGGCTCCCGCAGA No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057314604 Original CRISPR TCTGCGGGAGCCGCCGGGGC TGG (reversed) Intergenic
No off target data available for this crispr