ID: 1057314612

View in Genome Browser
Species Human (GRCh38)
Location 9:93960423-93960445
Sequence AGTCCAGTTACGCGAACCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057314603_1057314612 20 Left 1057314603 9:93960380-93960402 CCGCTCGCCAGCCCCGGCGGCTC No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314606_1057314612 8 Left 1057314606 9:93960392-93960414 CCCGGCGGCTCCCGCAGAGACCT No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314600_1057314612 24 Left 1057314600 9:93960376-93960398 CCCACCGCTCGCCAGCCCCGGCG No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314601_1057314612 23 Left 1057314601 9:93960377-93960399 CCACCGCTCGCCAGCCCCGGCGG No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314609_1057314612 -3 Left 1057314609 9:93960403-93960425 CCGCAGAGACCTTGCATCCGAGT No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314605_1057314612 9 Left 1057314605 9:93960391-93960413 CCCCGGCGGCTCCCGCAGAGACC No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314608_1057314612 -2 Left 1057314608 9:93960402-93960424 CCCGCAGAGACCTTGCATCCGAG No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314604_1057314612 13 Left 1057314604 9:93960387-93960409 CCAGCCCCGGCGGCTCCCGCAGA No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data
1057314607_1057314612 7 Left 1057314607 9:93960393-93960415 CCGGCGGCTCCCGCAGAGACCTT No data
Right 1057314612 9:93960423-93960445 AGTCCAGTTACGCGAACCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057314612 Original CRISPR AGTCCAGTTACGCGAACCAG CGG Intergenic
No off target data available for this crispr