ID: 1057318223

View in Genome Browser
Species Human (GRCh38)
Location 9:93986310-93986332
Sequence GGAAAGTTGTTTACTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057318223_1057318227 15 Left 1057318223 9:93986310-93986332 CCAGTTTCAGTAAACAACTTTCC No data
Right 1057318227 9:93986348-93986370 GTAGTTCACATCTGTTCCCCTGG 0: 56
1: 37
2: 16
3: 17
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057318223 Original CRISPR GGAAAGTTGTTTACTGAAAC TGG (reversed) Intergenic
No off target data available for this crispr