ID: 1057318862

View in Genome Browser
Species Human (GRCh38)
Location 9:93993429-93993451
Sequence AAAGCCTTCTTTACAAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057318858_1057318862 28 Left 1057318858 9:93993378-93993400 CCAAACAGTCACAGATAATACAC No data
Right 1057318862 9:93993429-93993451 AAAGCCTTCTTTACAAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057318862 Original CRISPR AAAGCCTTCTTTACAAAAAT AGG Intergenic