ID: 1057319379

View in Genome Browser
Species Human (GRCh38)
Location 9:93998286-93998308
Sequence AGTCATAAGACTTAGTGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057319379_1057319381 9 Left 1057319379 9:93998286-93998308 CCTGTACACTAAGTCTTATGACT No data
Right 1057319381 9:93998318-93998340 AGACAACATCAAATTCATGATGG No data
1057319379_1057319382 19 Left 1057319379 9:93998286-93998308 CCTGTACACTAAGTCTTATGACT No data
Right 1057319382 9:93998328-93998350 AAATTCATGATGGAAAGTTCAGG No data
1057319379_1057319383 27 Left 1057319379 9:93998286-93998308 CCTGTACACTAAGTCTTATGACT No data
Right 1057319383 9:93998336-93998358 GATGGAAAGTTCAGGTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057319379 Original CRISPR AGTCATAAGACTTAGTGTAC AGG (reversed) Intergenic
No off target data available for this crispr