ID: 1057319551

View in Genome Browser
Species Human (GRCh38)
Location 9:93999975-93999997
Sequence TTCTGGTTTACTATCCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057319548_1057319551 -4 Left 1057319548 9:93999956-93999978 CCTAGGAATGCAGCACTGCTTCT No data
Right 1057319551 9:93999975-93999997 TTCTGGTTTACTATCCTGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057319551 Original CRISPR TTCTGGTTTACTATCCTGGT AGG Intergenic
No off target data available for this crispr