ID: 1057322816

View in Genome Browser
Species Human (GRCh38)
Location 9:94030443-94030465
Sequence CACAGGAAGCGCGCCCGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057322813_1057322816 -1 Left 1057322813 9:94030421-94030443 CCAGTAGAAGCAGGAGGAACAAC No data
Right 1057322816 9:94030443-94030465 CACAGGAAGCGCGCCCGGAGAGG No data
1057322808_1057322816 30 Left 1057322808 9:94030390-94030412 CCGCGACGCCGTAAGAGTTGGGA No data
Right 1057322816 9:94030443-94030465 CACAGGAAGCGCGCCCGGAGAGG No data
1057322810_1057322816 22 Left 1057322810 9:94030398-94030420 CCGTAAGAGTTGGGACGATAGGA No data
Right 1057322816 9:94030443-94030465 CACAGGAAGCGCGCCCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057322816 Original CRISPR CACAGGAAGCGCGCCCGGAG AGG Intergenic
No off target data available for this crispr