ID: 1057326043

View in Genome Browser
Species Human (GRCh38)
Location 9:94065131-94065153
Sequence TGGCACTTACAACTAATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057326043 Original CRISPR TGGCACTTACAACTAATGAA AGG (reversed) Intronic
902568490 1:17331467-17331489 TGGGGCTTACAACCTATGAATGG + Intronic
903627162 1:24739464-24739486 TGCCACTTAAATCTAATAAATGG - Intergenic
918793487 1:188860546-188860568 TATCACTTTCAATTAATGAACGG - Intergenic
924414627 1:243846648-243846670 TGGCATTTTAAACAAATGAAAGG + Intronic
1062978474 10:1702313-1702335 TGGTAATTCCATCTAATGAATGG - Intronic
1065498049 10:26350223-26350245 TGTCCCTTGCAACTGATGAATGG + Intergenic
1069303401 10:66937446-66937468 TAGCAGTTGGAACTAATGAAGGG - Intronic
1070592357 10:77810196-77810218 AGGCACTTACAATCAAGGAAGGG + Intronic
1071747054 10:88433677-88433699 TAGCAATCATAACTAATGAAGGG + Intronic
1074094552 10:110299063-110299085 AGGCACTTAGAAATAATGCATGG - Intronic
1076101031 10:127778299-127778321 GGACACTTACAATGAATGAATGG + Intergenic
1079549499 11:21676378-21676400 TGGCATTTAAAAACAATGAAAGG + Intergenic
1080073144 11:28113983-28114005 TGGTGTTTTCAACTAATGAAGGG + Intronic
1080819742 11:35793967-35793989 AAGCACTTACAATTAATAAATGG - Intronic
1080845667 11:36024704-36024726 TGGCTTTTGCAACTAAGGAAGGG - Intronic
1081187364 11:40060561-40060583 TGGCACATAAAACTAGTGCATGG + Intergenic
1081885780 11:46494859-46494881 TGGCAGTTACTACTATTGCATGG - Intronic
1086737685 11:90327246-90327268 TTTCACTTGCAAATAATGAAAGG + Intergenic
1089237654 11:117046057-117046079 CTGCACTTACCACCAATGAATGG - Intronic
1092938164 12:13383311-13383333 AGGGACTGAAAACTAATGAATGG + Intronic
1097482900 12:60153358-60153380 TTGCACTTACAGTTTATGAATGG + Intergenic
1097887846 12:64747910-64747932 TGGCACATACTACAAAGGAAAGG + Exonic
1098206150 12:68111996-68112018 TATCACTTATTACTAATGAATGG - Intergenic
1098585204 12:72146164-72146186 AGCCACTTACAACTAATAAATGG - Intronic
1100736374 12:97538421-97538443 TGGCACTCAGAACTCATTAATGG + Intergenic
1101722654 12:107363638-107363660 TGGCAATTACAACTAAAAATGGG - Intronic
1104081034 12:125430766-125430788 TGGAACTTACATCTATAGAAAGG + Intronic
1109449298 13:62488542-62488564 TGGTATTTGCCACTAATGAATGG - Intergenic
1110582373 13:77145480-77145502 TGGCATTTAAAACTGAGGAATGG - Intronic
1112625910 13:101103441-101103463 TGGCACGTACAACCAGTGAGTGG - Intronic
1112856825 13:103782129-103782151 TGAAACTTAAAACTAATTAATGG - Intergenic
1114071980 14:19118949-19118971 TGGCATATAAAACAAATGAATGG - Intergenic
1114090277 14:19281015-19281037 TGGCATATAAAACAAATGAATGG + Intergenic
1117100926 14:52346261-52346283 GGGCACTTAAAACTCATCAATGG + Intergenic
1117877181 14:60265285-60265307 AGGCTCTTCCAACCAATGAAAGG - Intronic
1121064354 14:90947944-90947966 TGGCAATTATTACAAATGAAAGG - Intronic
1127206774 15:56728978-56729000 TGATACTTTCAACTAATGACGGG + Intronic
1128199744 15:65794058-65794080 CAACACTTAAAACTAATGAAAGG - Intronic
1129198652 15:73985665-73985687 TGGCACTTACCACAGCTGAAAGG - Intronic
1135729412 16:24881906-24881928 TGGCACTTAGAACAAATGTAAGG - Intronic
1135755315 16:25092465-25092487 TGCCACTTAGAAAAAATGAAAGG + Intergenic
1136126307 16:28184112-28184134 TTACACTTTCAAGTAATGAAAGG + Intronic
1140697845 16:77552664-77552686 TGGAGCTTACAACTATTGCAGGG + Intergenic
1149211930 17:54313838-54313860 TAACACTTAGAAATAATGAATGG - Intergenic
1149760342 17:59223212-59223234 CCGCATTTACAAATAATGAATGG - Intronic
1152398178 17:80047931-80047953 TGTCATTTGCAAGTAATGAAAGG - Intronic
1153481976 18:5556020-5556042 TGGGACTTGCATCTAGTGAAGGG - Intronic
1153776160 18:8456105-8456127 TGGCACTCAGAACTAATGAGAGG + Intergenic
1157171275 18:45408330-45408352 TAGCACCTACAATTAATGAGTGG + Intronic
1157381789 18:47225297-47225319 TGGCACTTACAAGAACTGAGTGG - Intronic
1168552160 19:57305347-57305369 TGGCATTTGCAAGGAATGAAAGG + Intergenic
925242391 2:2343116-2343138 TGTCACTTAGAACTGATTAAAGG - Intergenic
926317628 2:11722820-11722842 TAGCACTTAGAACAAATGATTGG + Intronic
926474621 2:13307476-13307498 AGGCATTTTGAACTAATGAAAGG - Intergenic
928863510 2:35889523-35889545 TGTCACTTGCAACAAATGGATGG - Intergenic
930007510 2:46909864-46909886 AGTCACTTACAATTCATGAATGG + Intronic
931910410 2:66893324-66893346 TGGTACTGGCAACTAGTGAATGG + Intergenic
932138278 2:69251106-69251128 TGGCACTTAAAACCAAGTAAAGG - Intergenic
932936672 2:76111033-76111055 TGGCAGATACACATAATGAAAGG + Intergenic
936755735 2:115709271-115709293 TGGCAGTTACAGCTACTCAAGGG - Intronic
939091608 2:137786637-137786659 AGGGACTGAAAACTAATGAAAGG + Intergenic
945037359 2:205715590-205715612 TGTCACTAACAATTAAAGAAGGG + Intronic
948255206 2:236563416-236563438 TGGCACTTACTACTATCCAAAGG - Intergenic
1170059446 20:12244204-12244226 TGGCACAAACTACTAATAAATGG + Intergenic
1170965379 20:21064692-21064714 TGGCACATGAAACTCATGAAAGG - Intergenic
1180490422 22:15841304-15841326 TGGCATCTAAAACAAATGAATGG - Intergenic
1181269289 22:21649653-21649675 TGGCACTTACCTCTACAGAAAGG - Intergenic
1181596043 22:23915459-23915481 GGGGACTTTGAACTAATGAAGGG + Intergenic
1181795435 22:25305410-25305432 TGGCAATTAAAAATAACGAATGG - Intergenic
1182793381 22:32972004-32972026 TGGCAGTTACATCCAATGACTGG - Intronic
950990447 3:17432513-17432535 TGGCTCTTAGATCTAATGAGTGG - Intronic
957855690 3:85874283-85874305 TGGCATTTACAACACAGGAAGGG - Intronic
959967241 3:112370641-112370663 TGGCTCTTAAAACAAATTAATGG - Intergenic
963492518 3:146018932-146018954 TGGAACTTACAACTATGGAAAGG - Intergenic
964108885 3:153068714-153068736 CGGCTCATACAATTAATGAATGG - Intergenic
964178980 3:153860454-153860476 TGGCTCATACTACTAATGCATGG - Intergenic
964429176 3:156586739-156586761 AGCCACTTACATCTACTGAAAGG - Intergenic
972392937 4:38630665-38630687 AGGAACTAACAACTAATGCAGGG + Intergenic
973645111 4:52942510-52942532 AGGCCCCCACAACTAATGAATGG - Intronic
975634564 4:76434361-76434383 TTGTACTTATAATTAATGAAAGG - Intergenic
979476052 4:121158508-121158530 TGGCACTGAAAATTAATGAACGG - Intronic
985147653 4:186910441-186910463 TGGCACTTCCTACAAATGCAAGG + Intergenic
991069663 5:62462954-62462976 TGGCTCTTACGACTAGTGAATGG + Intronic
991777522 5:70099662-70099684 AGGAACTTACAAATATTGAAAGG - Intergenic
991856810 5:70975106-70975128 AGGAACTTACAAATATTGAAAGG - Intronic
996793846 5:127322475-127322497 AAGCACTTACAACCAGTGAATGG - Intronic
997018040 5:129961110-129961132 TGGAAATTACAGCTAATGCATGG + Intronic
999172307 5:149605999-149606021 TGGCAATTACACCAAAGGAAAGG - Intronic
1003908861 6:10725666-10725688 GGGCACTTCCATCTAAGGAAAGG - Intronic
1003911922 6:10750894-10750916 GGGCACTTCCATCTAAGGAAAGG - Intronic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1006422186 6:33941939-33941961 TGGCACTGACCACCAATAAATGG - Intergenic
1007865183 6:44960706-44960728 TGGCAATTTCAGCAAATGAAAGG - Intronic
1007894043 6:45329948-45329970 TTTAACTTACAACTAATGACTGG + Intronic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1008320072 6:50101281-50101303 TGGCACTAGCAAATCATGAAGGG + Intergenic
1009548258 6:65050250-65050272 TAGCACTTACAACGAACTAAAGG + Intronic
1013136910 6:107291103-107291125 TGGCACTTATAATTAGTTAAAGG - Intronic
1014031695 6:116712980-116713002 TGGCAATAACAACTTAAGAAGGG - Intronic
1014766946 6:125417675-125417697 TTGCACTTACAAGGAATCAAGGG - Intergenic
1020549765 7:9588335-9588357 TGCCACTTCCAACTGATGATAGG - Intergenic
1022196424 7:28071666-28071688 CGGCACTTACAGCTGATTAAAGG + Intronic
1024608760 7:51045391-51045413 TGGCACTCACAGCTTCTGAAGGG + Intronic
1026263862 7:68779218-68779240 TTGCAATTATAACAAATGAATGG + Intergenic
1030571506 7:111230917-111230939 TGGAATTGATAACTAATGAATGG + Intronic
1030615389 7:111733178-111733200 TGCAACTCACAACTACTGAAAGG + Intronic
1032693694 7:134315224-134315246 TGCCACTTACAAGTAGTGAAGGG + Intronic
1034379265 7:150675859-150675881 TCCCACTTACAACTCAGGAATGG + Intergenic
1041165210 8:55085292-55085314 TGTTACACACAACTAATGAAAGG - Intergenic
1053115485 9:35497898-35497920 TGGCAGTTACAACAAAAGATAGG - Intronic
1054814683 9:69463796-69463818 TGGCACTTTCACCTAAACAAAGG - Intronic
1056955482 9:91077659-91077681 TGGAACTTACTAGAAATGAAAGG - Intergenic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1057611970 9:96552771-96552793 GGGCCCTTTCAACTAATGTACGG + Intronic
1186899659 X:14040179-14040201 TGGCACATGCATCTAATGAGTGG - Intergenic
1187100878 X:16190212-16190234 TGGCACTTACAGCTAAACCATGG - Intergenic
1187517413 X:19985120-19985142 TGGTATTTACAACTAATCGATGG - Intergenic
1188062960 X:25623570-25623592 TGGCACTTAAAACTAGTAACTGG - Intergenic
1188603325 X:31996467-31996489 TGCCACTCACAACTTAGGAAGGG - Intronic
1189095960 X:38140032-38140054 TGGCAGTTATAACCAATGATGGG - Intronic
1197130836 X:123003885-123003907 TGGCTTAAACAACTAATGAATGG + Intergenic
1197165918 X:123377447-123377469 AGGAACTTACAACTAATGGGAGG - Intronic
1199453936 X:148006576-148006598 TGGCATATACAGCTAATGATGGG - Intronic
1199582265 X:149372155-149372177 TGGCACGTACCACCAGTGAAGGG - Intergenic
1202252270 Y:22885516-22885538 TGGAACATACAACTAAGCAAAGG - Intergenic
1202405259 Y:24519265-24519287 TGGAACATACAACTAAGCAAAGG - Intergenic
1202465521 Y:25150817-25150839 TGGAACATACAACTAAGCAAAGG + Intergenic