ID: 1057326087

View in Genome Browser
Species Human (GRCh38)
Location 9:94065452-94065474
Sequence CAGTAGGACTAAAGTGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057326087_1057326092 14 Left 1057326087 9:94065452-94065474 CCACCTTCACTTTAGTCCTACTG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1057326092 9:94065489-94065511 AAGGATTTCTCCCCTAAGTATGG No data
1057326087_1057326096 27 Left 1057326087 9:94065452-94065474 CCACCTTCACTTTAGTCCTACTG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1057326096 9:94065502-94065524 CTAAGTATGGATTAGATGATAGG No data
1057326087_1057326091 -5 Left 1057326087 9:94065452-94065474 CCACCTTCACTTTAGTCCTACTG 0: 1
1: 0
2: 0
3: 20
4: 238
Right 1057326091 9:94065470-94065492 TACTGTATGGAGAACTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057326087 Original CRISPR CAGTAGGACTAAAGTGAAGG TGG (reversed) Intronic
901135690 1:6992684-6992706 CAGGAGGAAGAAAGTGAAGTGGG + Intronic
903592625 1:24468712-24468734 CAGTTGGCCTAAAGTGAGGTGGG - Intronic
904728285 1:32567197-32567219 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
905150284 1:35921761-35921783 CAGCAGGAAAAAAGTAAAGGAGG - Exonic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905993714 1:42362790-42362812 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
907448801 1:54528883-54528905 CAGTAGGATGTAAGTGAAAGTGG - Intergenic
907717013 1:56935375-56935397 AAGGAGGACAAAAGTTAAGGAGG - Intronic
909209173 1:72800676-72800698 CAGTGTGATTAAAGTGTAGGTGG - Intergenic
914734167 1:150399949-150399971 GATTAGGACTAAATTGAATGTGG + Intronic
916658337 1:166897921-166897943 CAGTTGGTCAAAAGTGCAGGTGG + Intergenic
917464756 1:175266324-175266346 CAGGAGGACTAAAGTGGGGTGGG + Intergenic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
919686582 1:200488593-200488615 GAGTAGGAAAAAAGTGAGGGAGG + Intergenic
921373638 1:214451026-214451048 AAGTGGGAGTAAAGTTAAGGAGG - Intronic
922169105 1:223140221-223140243 GAGTAGGCATAAAGTAAAGGAGG + Intronic
924504707 1:244670836-244670858 CATTTGGACTGTAGTGAAGGCGG - Intronic
1065229492 10:23582750-23582772 CAGTTGGTCTGAAGCGAAGGTGG + Intergenic
1065862091 10:29880429-29880451 AAGTAGGAAAAAAGGGAAGGGGG + Intergenic
1065867433 10:29926219-29926241 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1066674261 10:37872044-37872066 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1067092255 10:43273821-43273843 CAGTTGGTCAAAAGTGCAGGTGG - Intergenic
1068030777 10:51702241-51702263 CAGTGGGACTAAAGAGAACATGG - Intronic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1070366757 10:75744161-75744183 GAGTAGCACTAGAGTAAAGGCGG + Intronic
1071331759 10:84567491-84567513 CAATTGGACTAAAATCAAGGTGG - Intergenic
1071725976 10:88198676-88198698 CAGGAGGAAGAAAGAGAAGGGGG - Intergenic
1072234138 10:93438652-93438674 CTGTGGGAGTAAAGTGGAGGAGG + Intronic
1074440263 10:113471674-113471696 CATTAGAACTAAAGTCAAAGAGG + Intergenic
1075835371 10:125448412-125448434 CAGGAGGACGAAGGTGAAGGTGG - Intergenic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1080539777 11:33255042-33255064 CAATAGGTATAAAGTGAAGGGGG + Intergenic
1081024318 11:37990758-37990780 CAGTAGTATTAAAGTAAAGCTGG + Intergenic
1081158805 11:39728478-39728500 CAGAAGGAAGAAAGTGAAGGAGG + Intergenic
1081441345 11:43084952-43084974 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1084344615 11:68537917-68537939 GAGTGGGACTAAAGTGAAGTGGG + Intronic
1086799264 11:91151755-91151777 CAGAAGGAATAGAGTAAAGGGGG + Intergenic
1087541131 11:99521636-99521658 GAGGAGGACAAAAGTGATGGTGG - Intronic
1088513841 11:110606306-110606328 CAGTAGGAATAAGGTTAAAGGGG + Intronic
1088832291 11:113547661-113547683 CAGTAGGACAAGTGGGAAGGTGG - Intergenic
1092168320 12:6356843-6356865 GAGGAGGACTAAAGAGAAGAGGG + Intronic
1092840730 12:12538742-12538764 CGGCAGGACTCTAGTGAAGGGGG + Intronic
1097475312 12:60047913-60047935 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1097520105 12:60656701-60656723 CAGGAGGAAGACAGTGAAGGGGG - Intergenic
1099560345 12:84165234-84165256 CATTATGGCTAGAGTGAAGGAGG + Intergenic
1099724903 12:86412974-86412996 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1100743298 12:97618868-97618890 CAGTAGGAGCAAAGTCAAGGAGG - Intergenic
1101982584 12:109420513-109420535 GAGGAGGAATAGAGTGAAGGGGG + Intronic
1102039901 12:109794128-109794150 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1105572599 13:21617967-21617989 CTGTAGGAATAAAGTGGAGCTGG + Intergenic
1106658279 13:31770922-31770944 ATGTAGAACTAAAGAGAAGGTGG + Intronic
1107533629 13:41307642-41307664 CAGGAGGAATAGAGTGAAAGAGG - Intergenic
1107574061 13:41697829-41697851 GAGTAGGGGCAAAGTGAAGGGGG - Intronic
1109559920 13:64033416-64033438 CAGAAGGACTAAAGAAAATGTGG - Intergenic
1109642592 13:65209809-65209831 CAGGAGGAAGAAAGAGAAGGGGG + Intergenic
1110786067 13:79527876-79527898 CAGTGGGACAAATGTGGAGGTGG + Intronic
1110892910 13:80712783-80712805 CAGGAGGAAGAGAGTGAAGGTGG + Intergenic
1111571408 13:90091787-90091809 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1112440242 13:99419824-99419846 CAGATGGACTAAGATGAAGGGGG - Intergenic
1113149781 13:107250876-107250898 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1113458538 13:110465808-110465830 CTGTAGGACTACAGTGACAGAGG + Intronic
1113587779 13:111477016-111477038 CAAGAGGAATAGAGTGAAGGGGG - Intergenic
1113606143 13:111608386-111608408 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1115471400 14:33772325-33772347 CAGTAGGAGTCTATTGAAGGGGG - Intronic
1116007149 14:39306413-39306435 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1116662864 14:47734447-47734469 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1116737727 14:48715165-48715187 CTGAAGCACTAAAATGAAGGTGG - Intergenic
1117035113 14:51720486-51720508 CAGTAGTAATAAAGTGGAAGAGG + Intronic
1118995939 14:70836080-70836102 CAGTTGGTCAAAAGTGCAGGTGG + Intergenic
1119951999 14:78754706-78754728 CAGTAGGTCTAGAGTGGAGTGGG - Intronic
1122039871 14:98979556-98979578 CAGGAGGAAGAAAGTGAGGGGGG - Intergenic
1125756052 15:42065702-42065724 CAGCTGGTCTGAAGTGAAGGTGG - Intergenic
1125785325 15:42311645-42311667 CAGGAGGAATAAAGAGAGGGAGG + Intronic
1126951314 15:53884813-53884835 CAGTAGGAGTAAAGGGAAAGAGG - Intergenic
1127305917 15:57705786-57705808 AAATAGGCCTAAAGTGAAGAAGG + Intronic
1132349597 15:101131351-101131373 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1135055594 16:19229401-19229423 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1138671696 16:58620736-58620758 CAGTAGTACCACAGGGAAGGAGG + Intronic
1141556499 16:84839879-84839901 CAGTGGGACTGAGGTGGAGGTGG + Intronic
1142785763 17:2221343-2221365 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1147868468 17:43570185-43570207 AAGTAGGCCAAGAGTGAAGGAGG - Intronic
1150173675 17:63026461-63026483 CAGTAGGAATAAAGAGACAGAGG + Intronic
1155396041 18:25387741-25387763 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1156670097 18:39458621-39458643 CAGGAGAAAGAAAGTGAAGGGGG - Intergenic
1157788482 18:50508022-50508044 CAGAAGGACAAGAGTGAAGCTGG - Intergenic
1158294075 18:55974657-55974679 CAGTATCTCTAAGGTGAAGGAGG + Intergenic
1161584472 19:5097729-5097751 CAGAAGAACAAAAGGGAAGGTGG - Intronic
1163054632 19:14709095-14709117 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1165821698 19:38680772-38680794 TGGTAGGAATAAAGAGAAGGAGG - Intronic
925100053 2:1236506-1236528 CAGGAGGACAGAGGTGAAGGTGG - Intronic
926888463 2:17618914-17618936 CAGTAGGACCAAAGTGCTGGGGG - Intronic
929851942 2:45599472-45599494 CAATAGTACTAAAGAGGAGGTGG - Exonic
930578352 2:53180243-53180265 CAGTAGGGCTGAAGTGGAAGGGG + Intergenic
931022526 2:58064999-58065021 CAGTAGGCTTCAAGGGAAGGTGG - Intronic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
933917853 2:87014591-87014613 CAGCAGGACAAAGGTGAAGAGGG + Intronic
934005142 2:87755323-87755345 CAGCAGGACAAAGGTGAAGAGGG - Intronic
935325071 2:101928411-101928433 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
935768099 2:106389415-106389437 CAGCAGGACAAAGGTGAAGAGGG - Intergenic
936283814 2:111165391-111165413 GAGTTGGACTAAAATGCAGGAGG - Exonic
938318412 2:130345795-130345817 CAGTAGGACCAAAGGGCAGGTGG - Exonic
938957345 2:136310695-136310717 AATTAGTACTAAAATGAAGGAGG + Intergenic
939274052 2:139977271-139977293 CAGGAGGAAGAAAGAGAAGGGGG + Intergenic
940170169 2:150820470-150820492 CAGAAGTGCTAAAATGAAGGTGG + Intergenic
942557688 2:177188663-177188685 CAGGAGGTCAAAAGAGAAGGTGG - Intergenic
942828477 2:180209847-180209869 CATTGGTACTATAGTGAAGGTGG + Intergenic
944367625 2:198942750-198942772 CAGTATGATAAAAGTGAAAGAGG + Intergenic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
945509648 2:210685191-210685213 CAGGAGGAAGAAAGAGAAGGAGG + Intergenic
946119690 2:217499028-217499050 CAGTAGGAGTAGAATGAATGAGG + Intronic
946721018 2:222607621-222607643 GAGTAGGACTAAGGAGAAGTTGG + Intronic
948136122 2:235637593-235637615 TTTTAGGACAAAAGTGAAGGTGG + Intronic
1169613494 20:7411290-7411312 CAGGAGGAAGACAGTGAAGGGGG - Intergenic
1171490861 20:25516107-25516129 CAGGAGGAATAGAGTGAAGCGGG - Intronic
1172084185 20:32366445-32366467 CAGAAGGACTAAAGGAAATGAGG + Exonic
1172444309 20:34985077-34985099 CAGAGGGACCAAAGTGAATGCGG - Exonic
1173774759 20:45695152-45695174 CAGTAGATCAAAAGTGCAGGAGG + Intronic
1174706633 20:52662974-52662996 CAGTAGGACTAGGGTGAACCTGG + Intergenic
1174981582 20:55401479-55401501 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1176134340 20:63514655-63514677 CAGCAGGAAGAGAGTGAAGGGGG + Intergenic
1177955188 21:27589629-27589651 CAGTAGAACTAAGGTTAAGGAGG + Intergenic
1181944351 22:26504380-26504402 CAGTGGAACTAAATGGAAGGGGG - Intronic
1182016419 22:27043960-27043982 AAGAAGGACAAAAGGGAAGGAGG - Intergenic
1182967116 22:34532722-34532744 CAGGGGGACTACAGTGAGGGAGG - Intergenic
1183827042 22:40396738-40396760 CAGGAGGACCAGAGTGAATGGGG + Intronic
949127826 3:467770-467792 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
950342169 3:12257327-12257349 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
951121985 3:18940103-18940125 CAGGAGGAATAAAGAGTAGGGGG - Intergenic
952082101 3:29771803-29771825 CAGGAGGAAGAGAGTGAAGGAGG + Intronic
952803807 3:37325651-37325673 CCGTACAACTAAAGTTAAGGAGG + Exonic
953280030 3:41546208-41546230 CAGTAGCACTAAAAAGAAGGTGG - Intronic
953414142 3:42705873-42705895 AAGGAGGAGTAAAGGGAAGGTGG - Intronic
953616641 3:44496681-44496703 CAGTATGACAAAGGTGGAGGAGG - Intergenic
953691169 3:45120913-45120935 CAGGAGGACTGAAGTGGTGGGGG - Intronic
957506708 3:81130888-81130910 CAGGAGGAAGAAAGTGAAGGGGG - Intergenic
959434497 3:106297827-106297849 CAGTAGGAAGAAAGTGAAACAGG - Intergenic
960316160 3:116179619-116179641 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
960354534 3:116635041-116635063 CATTAGGAGAAAAGTGAAAGTGG + Intronic
962525146 3:136231238-136231260 CTGTAGGTCTGAAGTGAAGAAGG - Intergenic
964708861 3:159649840-159649862 TAGTAGGACCAAAGTGGAGGGGG + Intronic
967600256 3:191378470-191378492 CTGTATGGCAAAAGTGAAGGAGG + Intronic
969624534 4:8295567-8295589 CACTAGGGCTGAAGAGAAGGTGG - Intronic
971070439 4:23085145-23085167 CAGTTGGTCAAAAGTGAGGGTGG + Intergenic
971273642 4:25174707-25174729 CAGGAGGAGGAAAGTGTAGGAGG + Intronic
974512178 4:62857473-62857495 CAGAAGGAAGACAGTGAAGGAGG - Intergenic
975553170 4:75633577-75633599 AAGTAGGACTATAGTGGAAGAGG + Intergenic
976180529 4:82394738-82394760 CGGTAGGTCAGAAGTGAAGGTGG - Intergenic
976776389 4:88710973-88710995 CAGTGGGTCTCAAGTGAAGCTGG + Intergenic
977580003 4:98714506-98714528 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
978344733 4:107755416-107755438 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
979373371 4:119915482-119915504 CAGGAGAGATAAAGTGAAGGAGG + Intergenic
979595321 4:122528258-122528280 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
979606818 4:122646975-122646997 CAGTAGGAGAAAACTAAAGGAGG - Intergenic
980406909 4:132365700-132365722 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
983102687 4:163644816-163644838 CAGTGGGACCAAAGTTAAGCAGG - Intronic
983294591 4:165850143-165850165 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
983443728 4:167821601-167821623 CAGGAGGAAGACAGTGAAGGGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986511598 5:8512798-8512820 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
986588503 5:9344542-9344564 GAGCAGGACATAAGTGAAGGAGG + Intronic
987183115 5:15386725-15386747 CTGTAGGACTCAGGTGAGGGTGG - Intergenic
987859878 5:23470976-23470998 CACCAGGAGTAAAGAGAAGGAGG - Intergenic
988078767 5:26388710-26388732 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
988372526 5:30389750-30389772 CTGTAGTACTAAATTGAAAGGGG - Intergenic
989297221 5:39843515-39843537 CAGCAGGACTCAAGTCCAGGAGG - Intergenic
991163304 5:63531228-63531250 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
992304603 5:75423197-75423219 TAGAAGGACAAAAGTGATGGTGG - Intronic
992420236 5:76596681-76596703 CAGGAGGAATAGAGAGAAGGGGG + Intronic
992558307 5:77924914-77924936 CAGTAGCCTAAAAGTGAAGGTGG + Intergenic
992959697 5:81946367-81946389 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
993189985 5:84669435-84669457 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
995477982 5:112566870-112566892 CAGGAGGAAGAAAGTAAAGGAGG + Intergenic
995846124 5:116495596-116495618 CAGTAAGGTTAAAGTGGAGGTGG + Intronic
997273624 5:132563902-132563924 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
998395455 5:141815022-141815044 GAGTAGGACTAAGGTGGATGAGG + Intergenic
998767092 5:145500292-145500314 AAGAAGGATGAAAGTGAAGGGGG - Intronic
998803965 5:145900272-145900294 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
998930235 5:147173481-147173503 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1000230616 5:159312021-159312043 CAGCAGGACTCACCTGAAGGCGG - Intergenic
1000556251 5:162729773-162729795 TAGTATGAATAAAGTGAGGGAGG - Intergenic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1002978315 6:2109180-2109202 CACTGGGACTGAAGTGAAGGAGG + Intronic
1003019732 6:2499252-2499274 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1004076990 6:12352718-12352740 CAGGAGGAAGAGAGTGAAGGAGG + Intergenic
1004201152 6:13549226-13549248 CAGGAGGAAGAGAGTGAAGGAGG - Intergenic
1004519599 6:16349172-16349194 AAATAGGACCACAGTGAAGGAGG - Intronic
1004681965 6:17904589-17904611 AAGGAGGACTAAAATAAAGGAGG + Intronic
1005471561 6:26166410-26166432 AAGAAGGAATAAAGGGAAGGAGG - Intronic
1006917579 6:37604649-37604671 CAGTAGGAAAGAGGTGAAGGGGG + Intergenic
1009393973 6:63175912-63175934 GGGTAAGACTAAAGAGAAGGGGG - Intergenic
1009449478 6:63784592-63784614 CAGGAGGAAAAGAGTGAAGGGGG + Intronic
1011848800 6:91600719-91600741 CAGGAGGAAGAGAGTGAAGGTGG - Intergenic
1014209908 6:118697490-118697512 CAGTCCCACCAAAGTGAAGGTGG - Intronic
1014245218 6:119060780-119060802 CAGGAGGAAGAAAGAGAAGGGGG - Intronic
1014464926 6:121743822-121743844 TAGGAAAACTAAAGTGAAGGAGG + Intergenic
1015050839 6:128837599-128837621 CAGTAGGAAGAAAGTGAAGTGGG - Intergenic
1015267553 6:131303823-131303845 CAGGGGGAATAAAGTCAAGGGGG - Intergenic
1016589366 6:145728009-145728031 CAGGAGGAATAGAGAGAAGGGGG - Intronic
1018128943 6:160709589-160709611 CAGCAGGACAAAGGTGAAGAGGG - Intronic
1018882324 6:167896912-167896934 CAGTAACACTTAACTGAAGGCGG - Exonic
1019655279 7:2190769-2190791 CAGGATGGCTAAAGTGAAGGTGG + Intronic
1020620966 7:10518455-10518477 AAGTAGTACGAAGGTGAAGGTGG + Intergenic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1023275538 7:38515411-38515433 CAGGAGGAAGAGAGTGAAGGAGG - Intronic
1023649417 7:42352752-42352774 AAGTAGGACTGAAATGAGGGAGG + Intergenic
1023935889 7:44739461-44739483 CAGGAGGGGTGAAGTGAAGGTGG - Intergenic
1025101564 7:56139892-56139914 CAGGAGGAAGAAAGTGAAGGAGG + Intergenic
1026054281 7:66971084-66971106 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1028011614 7:85650547-85650569 CACTAGTCCTATAGTGAAGGTGG + Intergenic
1029061418 7:97801663-97801685 CAGTAGAAATAAAGCAAAGGAGG + Intergenic
1030857073 7:114572334-114572356 CTATAGGATTAAAGTGAATGAGG - Intronic
1034465782 7:151227662-151227684 GGGGAGGACTAAAATGAAGGGGG + Intergenic
1034953252 7:155315727-155315749 CAGTAGGAAGAAAGTGGAGCTGG + Intergenic
1035587830 8:789348-789370 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1037098358 8:15013523-15013545 CTGAAGGAATAAAGGGAAGGAGG - Intronic
1037747484 8:21658587-21658609 CAGGAGGAAGAAAGAGAAGGGGG + Intergenic
1040349196 8:46546073-46546095 CAGTAGCAATAAAGCAAAGGAGG + Intergenic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1042605337 8:70540615-70540637 AAGGAGGACTAGAATGAAGGGGG - Intergenic
1042605596 8:70542457-70542479 AAGGGGGACTAGAGTGAAGGGGG - Intergenic
1043431706 8:80201517-80201539 CAATAGGAAAAAAGTGGAGGCGG - Intronic
1045414654 8:101953837-101953859 CAGTTGGTCAAAAGTGCAGGTGG + Intronic
1045889280 8:107135194-107135216 CAGGAGGAAGAGAGTGAAGGGGG - Intergenic
1046809278 8:118515317-118515339 CAGGAGGAAGAAAGAGAAGGAGG - Intronic
1048337724 8:133515254-133515276 CAGTAGGACAAAGCAGAAGGGGG - Intronic
1048588367 8:135797239-135797261 CAGGAGGTCCAAAGTGAACGAGG + Intergenic
1050754137 9:8978849-8978871 CATTAGCAGTAAAGTGAAGCAGG - Intronic
1054725854 9:68649357-68649379 CAGTAGGGATAAAGTGGAGCTGG - Intergenic
1055725698 9:79226022-79226044 AAGTAGGAATGAAGGGAAGGAGG - Intergenic
1055982134 9:82014552-82014574 CAGCTGGTCTAAAGTGAAGGCGG + Intergenic
1057326087 9:94065452-94065474 CAGTAGGACTAAAGTGAAGGTGG - Intronic
1059099783 9:111459003-111459025 CAATAGGTCAAAAGTGAGGGTGG + Intronic
1060531146 9:124347640-124347662 CAGAAGGACTAGAGAGGAGGAGG - Intronic
1186112280 X:6270964-6270986 CAGTAGACTTTAAGTGAAGGAGG + Intergenic
1186746725 X:12577316-12577338 AAGTAGGAAGAAAGTGAGGGGGG + Intronic
1188115456 X:26237996-26238018 CAGGAGGAAGAGAGTGAAGGGGG + Intergenic
1188808487 X:34621634-34621656 AAGTGGCACTAGAGTGAAGGCGG + Intergenic
1189139868 X:38592049-38592071 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1189783351 X:44537040-44537062 CAGTAGAAGGAAAGTGAAAGGGG - Intronic
1190391464 X:49935775-49935797 CAGCAGGACCATAGTGAATGAGG + Intronic
1190866377 X:54388351-54388373 CAGGGGGACAAAAGTGGAGGAGG - Intergenic
1190947905 X:55113846-55113868 CACCAGCACTAATGTGAAGGTGG + Intronic
1191178219 X:57529461-57529483 AAGTGGGACTTGAGTGAAGGAGG - Intergenic
1192081745 X:68054361-68054383 TAGTAGGACTATAGTGAAACAGG + Intronic
1193448796 X:81641009-81641031 AAGTATGAAGAAAGTGAAGGAGG + Intergenic
1193999828 X:88413887-88413909 GAGTAAGATTAAAGTGAAGTAGG + Intergenic
1194288963 X:92045358-92045380 CAGAAGGATTACAGTGCAGGTGG + Intronic
1195961217 X:110388686-110388708 CAGTAGGTCTGAAGTGAGTGGGG + Intronic
1196107752 X:111914514-111914536 CAGTAGGAGAAAGGTGGAGGAGG + Intronic
1196630644 X:117935621-117935643 CAGGAGGAAGAGAGTGAAGGGGG + Intronic
1198506755 X:137308872-137308894 CAGGAGGAATAGAGTGAAGGAGG - Intergenic
1198911774 X:141623031-141623053 CACTAGGAATAAAGTGATGATGG + Intronic
1200273357 X:154709136-154709158 CAGGAGGAAGAGAGTGAAGGGGG - Intronic
1200606481 Y:5269926-5269948 CAGAAGGATTACAGTGCAGGTGG + Intronic
1201248365 Y:12029822-12029844 GAGGATCACTAAAGTGAAGGAGG - Intergenic
1201483760 Y:14470284-14470306 CAGTAGACTTTAAGTGAAGGAGG - Intergenic