ID: 1057326985

View in Genome Browser
Species Human (GRCh38)
Location 9:94074582-94074604
Sequence CTCCTCATACAGGTGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057326978_1057326985 -9 Left 1057326978 9:94074568-94074590 CCACCACCTCTTTCCTCCTCATA 0: 1
1: 1
2: 9
3: 84
4: 885
Right 1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG No data
1057326972_1057326985 7 Left 1057326972 9:94074552-94074574 CCAAGCCTCCCACTCCCCACCAC 0: 1
1: 0
2: 16
3: 196
4: 1570
Right 1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG No data
1057326976_1057326985 -7 Left 1057326976 9:94074566-94074588 CCCCACCACCTCTTTCCTCCTCA 0: 1
1: 1
2: 5
3: 87
4: 869
Right 1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG No data
1057326977_1057326985 -8 Left 1057326977 9:94074567-94074589 CCCACCACCTCTTTCCTCCTCAT 0: 1
1: 0
2: 5
3: 60
4: 666
Right 1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG No data
1057326975_1057326985 -2 Left 1057326975 9:94074561-94074583 CCACTCCCCACCACCTCTTTCCT 0: 1
1: 0
2: 18
3: 191
4: 1752
Right 1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG No data
1057326973_1057326985 2 Left 1057326973 9:94074557-94074579 CCTCCCACTCCCCACCACCTCTT 0: 2
1: 0
2: 14
3: 160
4: 1533
Right 1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG No data
1057326974_1057326985 -1 Left 1057326974 9:94074560-94074582 CCCACTCCCCACCACCTCTTTCC 0: 1
1: 1
2: 6
3: 108
4: 1040
Right 1057326985 9:94074582-94074604 CTCCTCATACAGGTGGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057326985 Original CRISPR CTCCTCATACAGGTGGAGTT GGG Intronic
No off target data available for this crispr