ID: 1057328064

View in Genome Browser
Species Human (GRCh38)
Location 9:94084627-94084649
Sequence CGGCTGCAGCAGGCCCGGCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 345}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057328052_1057328064 14 Left 1057328052 9:94084590-94084612 CCAGGGCCGCCGGCACTCCACCT 0: 1
1: 0
2: 0
3: 6
4: 136
Right 1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG 0: 1
1: 0
2: 2
3: 42
4: 345
1057328051_1057328064 21 Left 1057328051 9:94084583-94084605 CCTTTCTCCAGGGCCGCCGGCAC 0: 1
1: 0
2: 2
3: 10
4: 122
Right 1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG 0: 1
1: 0
2: 2
3: 42
4: 345
1057328054_1057328064 5 Left 1057328054 9:94084599-94084621 CCGGCACTCCACCTCAGACCCAG 0: 1
1: 0
2: 0
3: 28
4: 389
Right 1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG 0: 1
1: 0
2: 2
3: 42
4: 345
1057328057_1057328064 -6 Left 1057328057 9:94084610-94084632 CCTCAGACCCAGTACTGCGGCTG 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG 0: 1
1: 0
2: 2
3: 42
4: 345
1057328053_1057328064 8 Left 1057328053 9:94084596-94084618 CCGCCGGCACTCCACCTCAGACC 0: 1
1: 0
2: 0
3: 11
4: 186
Right 1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG 0: 1
1: 0
2: 2
3: 42
4: 345
1057328055_1057328064 -3 Left 1057328055 9:94084607-94084629 CCACCTCAGACCCAGTACTGCGG 0: 1
1: 0
2: 2
3: 13
4: 128
Right 1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG 0: 1
1: 0
2: 2
3: 42
4: 345
1057328049_1057328064 29 Left 1057328049 9:94084575-94084597 CCTCAGCTCCTTTCTCCAGGGCC 0: 1
1: 2
2: 24
3: 71
4: 518
Right 1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG 0: 1
1: 0
2: 2
3: 42
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057328064 Original CRISPR CGGCTGCAGCAGGCCCGGCG GGG Exonic
900113775 1:1020186-1020208 CGGCCGCAGCGGGCCCGGGTGGG - Exonic
900689140 1:3969227-3969249 CTGCTGTAGCAGGCCCTGAGCGG + Intergenic
901626318 1:10627191-10627213 CGGCTGCAGGAGGACCTGGGTGG - Intronic
902234229 1:15047478-15047500 CGGCAGCTGCAGGCCGGGCGTGG + Intronic
902587054 1:17446184-17446206 AGGCAGCAGGAGGCCGGGCGTGG - Intergenic
902786817 1:18738323-18738345 CGGCAGCGGCAGCCCCGGCCTGG + Intronic
903034109 1:20483976-20483998 TGGCTGCAGCAGGAGCGGCTGGG - Intronic
903828653 1:26161980-26162002 CGGAGGCAGCGGGCTCGGCGCGG + Exonic
903907459 1:26696670-26696692 CAGCGGCGGCGGGCCCGGCGCGG + Exonic
904024037 1:27490879-27490901 AGGCTGCAGCTGTCCGGGCGCGG + Intergenic
905469853 1:38183365-38183387 CGGCTGCATGGGGCCAGGCGGGG + Intergenic
906240216 1:44238227-44238249 TGGCTGCGGCAGGCGGGGCGGGG + Intronic
906650363 1:47508461-47508483 CCGCGGCCGCAGGCCCGGCACGG + Intergenic
908293214 1:62688294-62688316 CGGCTGCGGCGGGCCGGGTGCGG + Exonic
908506060 1:64801577-64801599 TGGCTGCTCCAGGCCGGGCGCGG + Intronic
909856847 1:80545115-80545137 CTGCTACATCAGGCCTGGCGTGG - Intergenic
911052402 1:93681808-93681830 CGCCTGCTGCTGGCCGGGCGGGG - Intronic
912360222 1:109089039-109089061 CAGCAGCAGCTGGCCGGGCGCGG - Intergenic
915903458 1:159862335-159862357 CGGCTGCAGCAGGGCAAGGGTGG + Intronic
916107311 1:161441324-161441346 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916108898 1:161448742-161448764 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916110486 1:161456123-161456145 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916112071 1:161463533-161463555 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
916113658 1:161470914-161470936 CGGCGGCGGCCGGCCCGACGCGG + Intergenic
919981103 1:202643384-202643406 CCGCAGCGGCAGGGCCGGCGGGG - Exonic
920700810 1:208217007-208217029 CGGCTGCACCCGGGCCGGGGTGG - Exonic
922784832 1:228277680-228277702 CGGCTGTAGCAGGCACGGCCCGG + Intronic
922911938 1:229225614-229225636 AGGCTGCAGCATGCCCTGCCTGG - Intergenic
923726114 1:236506870-236506892 AGGCAGGAGCAGGCCGGGCGTGG + Intergenic
1062774824 10:135859-135881 CGGCCCGAGCAGGCCCCGCGCGG - Intronic
1063009804 10:2011252-2011274 GGGCTGGAGCAGGCACAGCGTGG + Intergenic
1065140550 10:22714731-22714753 CGGCTGCAGCGGAGCCGGGGCGG - Intergenic
1065818754 10:29506529-29506551 CTGCTGGAGCAGGCCCATCGCGG + Intronic
1065954166 10:30677867-30677889 CTGCTGGAGCAGGCCCATCGCGG - Intergenic
1067703022 10:48587270-48587292 GGGCTGCATCAGGCCCTGGGAGG + Intronic
1069474590 10:68721456-68721478 GGGTCGGAGCAGGCCCGGCGCGG + Intronic
1070742895 10:78914058-78914080 CGGCAGCAGCCGGGCCGGCTCGG - Intergenic
1071527488 10:86366727-86366749 CGGCGGCGGCCGGGCCGGCGTGG + Intergenic
1071847524 10:89535683-89535705 GGGCTGCAGTGGTCCCGGCGAGG - Intronic
1074790956 10:116887385-116887407 CAGCTGCAGCAGGCAGGGCTGGG + Intronic
1074853243 10:117455457-117455479 CAGCTGGAGCAGGCCTGGCCTGG - Intergenic
1075037426 10:119080837-119080859 GGGCGGCAGCAGGGCCGCCGCGG - Intergenic
1075054357 10:119207024-119207046 CGGCGGCGGCCGGCCCGGCCTGG - Intergenic
1076157031 10:128212102-128212124 CGGCCGCGGGAGGCCCAGCGGGG + Intergenic
1076864399 10:133160021-133160043 GGGCTGCCGCAGTCCCGGGGTGG - Intergenic
1076994368 11:290958-290980 CAGCTGCGCCAGGCCCTGCGTGG + Exonic
1077091853 11:782254-782276 AGGGTGCAGCAGCCCCGGGGAGG + Intronic
1077327590 11:1970441-1970463 GGGCTGGAGCAGACCCGGGGTGG - Intronic
1077474234 11:2778858-2778880 CGGCTGCAGCCGGGCAGGCGGGG + Intronic
1077474385 11:2779466-2779488 CGGCTGCAGCCAGGCAGGCGGGG + Intronic
1077495932 11:2886394-2886416 CAGCAGCAGCAGGCCGCGCGGGG - Intergenic
1078077923 11:8178421-8178443 CAGCTGCAGCAAGCCCAGCGAGG - Intergenic
1078635811 11:13048813-13048835 ATGATGCAGCCGGCCCGGCGCGG - Intergenic
1080337525 11:31215502-31215524 TGGAGGCAGCAGGCCTGGCGCGG + Intronic
1081937995 11:46918146-46918168 CGGCTCCAGCAGTCCGAGCGGGG - Intronic
1082816869 11:57514961-57514983 AGGCTGCAGCGGCCGCGGCGGGG - Intronic
1083596703 11:63921041-63921063 AGGATGCAGCAGACCAGGCGCGG + Intergenic
1083656165 11:64230714-64230736 AGACTGAAGCAGGCCCGGAGAGG - Exonic
1083663880 11:64264478-64264500 CGCCTGCCGCAGGCCCTGGGGGG - Intronic
1083939449 11:65887853-65887875 CGGCTGAAACAGGCCCAGGGAGG - Intronic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084438413 11:69157234-69157256 CCGCAGCAGCAGGCCCGGGATGG - Intergenic
1084652039 11:70495151-70495173 CGGCTGCAGCAGGTGCTGCATGG + Intronic
1084661279 11:70548021-70548043 AGGCTGCACCAGGCCAGGCCAGG - Intronic
1084785892 11:71441501-71441523 GGGCTGAAGCATGCCTGGCGGGG + Intronic
1084973921 11:72786059-72786081 AGGGTGCAGCAGGCCGGGCGCGG + Intronic
1085527326 11:77172044-77172066 CGGCAGCAGCAGGCTGGGGGCGG - Intronic
1085784783 11:79440010-79440032 CGGCTGCAGCAGCCCCGCACGGG - Intronic
1085784790 11:79440040-79440062 CGGCTGCAGCCTGCCCTGCGGGG - Intronic
1086947186 11:92854454-92854476 CAGCTGCAGCAGGGAAGGCGTGG - Intronic
1089851451 11:121500407-121500429 CGTCTGCAGCATGCAAGGCGTGG - Intronic
1091079235 11:132651034-132651056 CGGTTGCAGCAGGCCCAGGGAGG - Intronic
1091226028 11:133956864-133956886 GGGCTGCAGGAGCACCGGCGCGG - Exonic
1202810572 11_KI270721v1_random:25621-25643 GGGCTGGAGCAGACCCGGGGTGG - Intergenic
1091400175 12:176535-176557 CGGCTACTGCAGGCGGGGCGGGG - Exonic
1091630943 12:2160451-2160473 AGGCTGCAGCAGGCCCTCTGTGG - Intronic
1092246559 12:6867405-6867427 CGGCGGCAGGAGGGCGGGCGGGG + Exonic
1096241396 12:49961979-49962001 CGGCGGCAGCTGCCGCGGCGGGG - Exonic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1098255401 12:68610951-68610973 CGGCAGCGGCAGGACCGCCGTGG + Exonic
1101865525 12:108517079-108517101 CGGCAGCAGCAGGGCCAGCAGGG - Exonic
1102278187 12:111598788-111598810 CGGCGGCGGGAGGCCCGGCCTGG - Exonic
1103362438 12:120362003-120362025 GGGAAGCAGCAGGCCCGGCTCGG - Intronic
1103918946 12:124389606-124389628 CGGCAGCATCAGGCCAGGCAGGG - Intronic
1104690093 12:130819078-130819100 CGGCTGCAGGTGGCGCGGCGCGG + Intronic
1104769539 12:131352481-131352503 TGGTTCCAGCAGGCCCGGCCAGG - Intergenic
1104958491 12:132477200-132477222 CAGCTGCAGCAGGGCTGGGGAGG - Intergenic
1105423448 13:20273049-20273071 CTCCTTCAGCAGGCCCGGCTGGG - Intergenic
1105927085 13:25018302-25018324 GGGCTGCAGAGGGCCCAGCGCGG - Intergenic
1106197841 13:27509376-27509398 TGGCAGCAGCAGGCCAGACGGGG - Intergenic
1107508658 13:41060546-41060568 CTTCTCCAGCAGGCACGGCGTGG + Intronic
1107534232 13:41311904-41311926 GGGCTGCTGCGAGCCCGGCGCGG - Intronic
1107989247 13:45802779-45802801 AGGCAGCTGCAGGCCAGGCGTGG + Intronic
1111396066 13:87671795-87671817 CGGCGGCGGCGGGCTCGGCGCGG + Intergenic
1111417414 13:87967555-87967577 AAGATGAAGCAGGCCCGGCGCGG + Intergenic
1111464865 13:88595180-88595202 CAGCTGCAGCAGGCGAGGCATGG - Intergenic
1112325797 13:98442135-98442157 CGACTGCAGCAGCCCCGCAGAGG - Intronic
1113379039 13:109786420-109786442 CGGCGGCAGCAGCCCCGGTGCGG - Exonic
1117252947 14:53953741-53953763 TGGCTTCAGGTGGCCCGGCGCGG - Intronic
1117722068 14:58638017-58638039 CGGCTGCTGCTGTCCCGGCCCGG - Intronic
1118415348 14:65529521-65529543 CAGATGCAGGAGGCCGGGCGTGG - Intronic
1118992378 14:70808813-70808835 CGGCTGGAGAAGGCGCTGCGCGG + Exonic
1120410759 14:84152544-84152566 CGGCTGCACCAGGGCAGGCGTGG + Intergenic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1121357781 14:93230298-93230320 CGGCTGCAGAAGGCCAGTCCAGG + Intergenic
1121733906 14:96204967-96204989 CGGCTGGAGCAGCCCCTGCCCGG - Intronic
1121969618 14:98344293-98344315 CTGCTGCAGCAGGTCTGGCTGGG - Intergenic
1122082219 14:99273921-99273943 CGGGTGCAGCCTGCCCGGCCAGG - Intergenic
1122470751 14:101964496-101964518 CGGCTGCGGCCGGCGGGGCGGGG + Intergenic
1122543297 14:102509491-102509513 CGGCGGCCGCGGGCGCGGCGCGG + Intronic
1122923001 14:104887612-104887634 CGGCTGAGGCGGGCCCGGCTGGG + Exonic
1123964084 15:25438501-25438523 CGGCCGCCGCAGCCCAGGCGCGG - Exonic
1124496796 15:30192114-30192136 CCGCAGCGGCAGGGCCGGCGGGG - Intergenic
1124746780 15:32346533-32346555 CCGCAGCGGCAGGGCCGGCGGGG + Intergenic
1125508947 15:40282694-40282716 CGGCTGCAGCCGCCCACGCGCGG - Intronic
1125578235 15:40769162-40769184 CGGCTGCAGCAGTCCCAGCTAGG + Intronic
1127867258 15:63042784-63042806 GGGCTGCAGCAGGAGCGGCGGGG - Exonic
1128393374 15:67198446-67198468 CGGCTTCAGTAGGCCTGGCGTGG - Intergenic
1128830435 15:70763481-70763503 CGGCTGCAGCAGAGGCGGCGCGG + Exonic
1130616149 15:85409919-85409941 TAGCTGCATCAGGCCAGGCGCGG - Intronic
1130769855 15:86913571-86913593 AGGCTGAAGCAGGCAAGGCGTGG + Intronic
1132599347 16:767092-767114 TGGCAGCAGACGGCCCGGCGAGG - Intronic
1132745620 16:1435003-1435025 CGCCTGCAGCAGGGCAGGCGGGG + Intronic
1132845453 16:1999057-1999079 TGGGGGCACCAGGCCCGGCGGGG + Exonic
1132851537 16:2027010-2027032 CGGCCGCAGCGGCTCCGGCGCGG - Exonic
1132973849 16:2701897-2701919 AGGCTGCAGCAGACCCGCCCTGG + Intronic
1133029643 16:3004347-3004369 CGGGTGCGGCAGGGACGGCGGGG - Intergenic
1133270950 16:4610591-4610613 GGGCAGCGGCAGGGCCGGCGGGG - Intronic
1133304367 16:4800435-4800457 AGGCGGCAGCAGGCCTGCCGCGG - Intronic
1134412845 16:14017344-14017366 AGACTGCAGCAGGCCGGGCGCGG - Intergenic
1134539801 16:15055570-15055592 GGGCTGCAGCCGCCCCGTCGGGG + Intronic
1135521578 16:23182509-23182531 GGGCGGCAGCAGGCACTGCGCGG + Intergenic
1135681828 16:24463875-24463897 CTGATGCAGCAGGTCCAGCGTGG - Intergenic
1136243598 16:28959856-28959878 TGAATGCAGCAGGCCAGGCGCGG - Intronic
1136779262 16:32886462-32886484 CGGCTGCAGCCTGCCAGGAGCGG - Intergenic
1136891355 16:33975056-33975078 CGGCTGCAGCCTGCCAGGAGCGG + Intergenic
1137574649 16:49590817-49590839 GGGCTCCAGCCGGCCCGGTGAGG + Intronic
1137617792 16:49857318-49857340 CGGCGGCGGCAGGCACGGCGCGG + Intronic
1137847986 16:51710594-51710616 CTGCTCCAGCAGGTCCGGGGAGG - Intergenic
1138349656 16:56339709-56339731 TGGCAGCCGCAGGCCCGGCTGGG - Intronic
1138597556 16:58037120-58037142 CGGCAGGAGCATGCCCGGCTGGG + Intronic
1141050548 16:80758830-80758852 GTGCTGCAGCAGGCCGGGCGTGG - Intronic
1141642423 16:85348974-85348996 CGGCTGCAGCGCTCCCGGCTGGG - Intergenic
1142264414 16:89057214-89057236 AGGAGGCAGCAGGCCCAGCGGGG + Intergenic
1203081678 16_KI270728v1_random:1148550-1148572 CGGCTGCAGCCTGCCAGGAGCGG - Intergenic
1142549795 17:731986-732008 CGGCTGCAGCCGCTCCGGGGTGG - Intergenic
1142988154 17:3710134-3710156 AGACTGCAGGAGGCCGGGCGTGG + Intergenic
1143495228 17:7308473-7308495 TGCCTGCAGCAGGCCCTCCGGGG - Intronic
1144339747 17:14301688-14301710 CAGGAGCAGCAGCCCCGGCGCGG - Exonic
1144742463 17:17591649-17591671 TGGCTGCAGCGGGGCCCGCGTGG - Exonic
1145037189 17:19549482-19549504 TTGCTGGAGCAGGCCGGGCGCGG - Intronic
1145889543 17:28405316-28405338 CTGGAGCAGCAGGCCCAGCGAGG + Exonic
1145889731 17:28406060-28406082 CGGCAGCCGCAGGGCGGGCGCGG + Exonic
1147044463 17:37743069-37743091 CAGCTGCGGCCAGCCCGGCGCGG + Intronic
1147539184 17:41342777-41342799 CACCTGCAGCAGGCTCAGCGAGG + Intergenic
1147740799 17:42670111-42670133 CGGGCGGAGCGGGCCCGGCGCGG - Exonic
1148021689 17:44557705-44557727 CGGCAGCAGCAGGCGGGGCAGGG - Exonic
1148282878 17:46362508-46362530 GAACTTCAGCAGGCCCGGCGCGG + Intergenic
1148305095 17:46580433-46580455 GAACTTCAGCAGGCCCGGCGCGG + Intergenic
1148646982 17:49224882-49224904 CGGGAGCCGCTGGCCCGGCGCGG + Exonic
1149467817 17:56893523-56893545 CAGCTGCAGCAGGCTTGGTGGGG - Intronic
1150236314 17:63595656-63595678 CGGCAGCAGCAGCCACGGCAAGG + Intergenic
1151324286 17:73369337-73369359 CTGGTGCAGCGGGCCCGGGGTGG - Intronic
1151598450 17:75091792-75091814 AGGCTGCAGCAGGCACTGCGAGG - Intronic
1151661731 17:75522484-75522506 CGGCTGCAGCAGGGCCTGTGTGG + Intronic
1151970551 17:77455381-77455403 CGGGGGCAGCAGGCCCTGCCGGG - Intronic
1152321407 17:79610419-79610441 CGGCGGCACAATGCCCGGCGCGG - Intergenic
1153457266 18:5295378-5295400 CGGCTGTAGGCGGCGCGGCGGGG + Intronic
1153688102 18:7566874-7566896 CGGGTGCAGCTGGCCCTGTGCGG + Exonic
1157421697 18:47553308-47553330 CGTCAGCTGCAGGCCTGGCGAGG - Intergenic
1157541615 18:48514921-48514943 CACCTGCAGCTGGCCCAGCGTGG + Intergenic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160822570 19:1065349-1065371 GGGGTGCTGCAGGCCTGGCGCGG - Exonic
1161069660 19:2253735-2253757 CGGCGGCTGCAGGGGCGGCGCGG + Exonic
1161407659 19:4099412-4099434 CGGCTGCAGCAGAGCCAGGGAGG + Exonic
1161610386 19:5238819-5238841 CCACTGCAGCAGGCCCCGCCTGG + Intronic
1161967538 19:7556733-7556755 CGGTTGCTGCAGGCTGGGCGGGG - Intronic
1162176430 19:8833034-8833056 GGGCTGCACCAGGCCTGGGGAGG + Intronic
1162345187 19:10114589-10114611 CGGCAGCAGCAGCCCAGGCTGGG - Exonic
1162752651 19:12838410-12838432 CGGCTGCAGCCGGCCGGGAGGGG - Intronic
1162767745 19:12930289-12930311 CGGCTCCAGCTGGTCCGGGGGGG - Exonic
1163219774 19:15910259-15910281 AGACTGCAACAGGCCGGGCGCGG + Intergenic
1163395160 19:17055815-17055837 CGTGTGCAGCAGGCGGGGCGAGG - Intronic
1163675205 19:18652297-18652319 GGGCTCCAGCAGGCCAGGTGCGG + Intronic
1163871154 19:19822253-19822275 AGGCTGCAGCTGGCCAGGCTTGG - Intergenic
1166951516 19:46431524-46431546 CGGAGGCATCAGGCCGGGCGCGG - Intergenic
1167495365 19:49815060-49815082 AGGCTTCAGCAGGCCAGGCGCGG + Intronic
1167497825 19:49829856-49829878 CGGCTCCAGCAAGGCCGGGGGGG - Exonic
1167529902 19:50008693-50008715 AGGCTGCAGCAGGCACGGGGGGG + Intronic
1168318896 19:55497049-55497071 AGGGAGCAGCAGGCCCGGCACGG - Intronic
1168368558 19:55811470-55811492 CAGCTGCAGCAGGGCTGGTGTGG + Intronic
926008738 2:9392315-9392337 CTGCTGCAGCAGCCCTGGAGTGG + Intronic
926217111 2:10912378-10912400 CGGCTGCAGGGGGCGCGGGGCGG + Exonic
927915346 2:26932380-26932402 GAGCTTCAGCAGGCTCGGCGGGG - Intronic
929922403 2:46182092-46182114 CGGCTCCAGCTCCCCCGGCGTGG + Intronic
930734585 2:54763760-54763782 CAGCTTCAGCAGGCCTGGCAGGG + Intronic
931282306 2:60804867-60804889 CGGCTGCAGCAGGGAAGGTGCGG - Intergenic
932420303 2:71597520-71597542 CGGATTCAGCAGGGCCGGGGTGG - Intronic
933385913 2:81609906-81609928 AGGCAGAAGCAGGCCGGGCGCGG - Intergenic
934113813 2:88765580-88765602 GGGCTGCAGAGGGCCCAGCGCGG + Intergenic
934251575 2:90360037-90360059 GGGCTGCAGCAGCCCAGGAGCGG + Intergenic
934257984 2:91443361-91443383 GGGCTGCAGCAGCCCAGGAGCGG - Intergenic
934636213 2:95992091-95992113 GGGCTGCAGAGGGCCCAGCGCGG - Intergenic
934797437 2:97113335-97113357 GGGCTGCAGAGGGCCCAGCGCGG + Intergenic
934835975 2:97590104-97590126 GGGCTGCAGAGGGCCCAGCGCGG - Intergenic
936556019 2:113499428-113499450 GGGCTGCAGGTGGCCCGGTGGGG + Exonic
937315830 2:120931618-120931640 GGTCTGCAGCAGGCCAGGCACGG + Intronic
937986431 2:127640181-127640203 AGGCTGCCGCAGGCCCGGCTGGG + Intronic
940862314 2:158783332-158783354 CAGCTGCCTCAGGCCGGGCGTGG - Intergenic
940957071 2:159739266-159739288 CGGCTGCAGCAGGGGAGGCGTGG - Intronic
941432222 2:165426737-165426759 TGGCTGCAGCAGGGGAGGCGTGG + Intergenic
942145738 2:173024505-173024527 GTGCTGCAGCAGGCCGGGCGCGG - Intronic
942543400 2:177038016-177038038 CAGCTGGAGCAGGACTGGCGAGG - Intergenic
944221683 2:197310292-197310314 CGGCGGCCGCGGGCCCGGCGGGG - Intronic
946395635 2:219442438-219442460 GGGCTGGGGCAGGCCGGGCGGGG - Intronic
947399054 2:229714358-229714380 CAGCAGCAGCAGGGCCAGCGCGG + Exonic
947503638 2:230690538-230690560 TAGCTGCAGCAGTCCAGGCGCGG + Intergenic
948728202 2:239947404-239947426 TGGCTGCAGGAAGCCCAGCGGGG - Intronic
948796582 2:240405946-240405968 TGGCCACAGCAGGCCCGGCCAGG + Intergenic
949049719 2:241890963-241890985 CGGCACCGACAGGCCCGGCGGGG + Intergenic
949049742 2:241891026-241891048 CGGCACCAACAGGCCCGGGGGGG + Intergenic
1169065643 20:2693019-2693041 CGGCGTCTGCTGGCCCGGCGCGG + Exonic
1170972121 20:21125998-21126020 CTCCTGCAGGCGGCCCGGCGCGG + Intronic
1171012974 20:21518495-21518517 CGGCTGGAGCGGGCGCGGGGAGG + Intergenic
1171487419 20:25494678-25494700 CGGCTGCAGGAGGTGCAGCGGGG + Intronic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172969881 20:38865579-38865601 AGAATGCAGCAGGCCGGGCGCGG - Intronic
1173640380 20:44597699-44597721 CCGCAGCAGGAGGCCCGGGGAGG - Intronic
1173704666 20:45101017-45101039 CTGCAGCAGGAGGCTCGGCGGGG - Exonic
1173767777 20:45629856-45629878 CTGCTGCTGCAGGCCCAGGGAGG + Exonic
1173773797 20:45685928-45685950 CTGCTGCTGCAGGCCCAGGGAGG - Intronic
1174077492 20:47948272-47948294 CGGCTGGGGCAGGCCGGGCGCGG + Intergenic
1174317448 20:49713717-49713739 CTGCGGGAGCAGGCCCGGCCTGG - Exonic
1175573275 20:60040169-60040191 CTGGTGCAGCAGGCCTGGGGTGG - Intergenic
1176152676 20:63600425-63600447 AGACTGCAGCAGGCCGGGCGCGG + Intronic
1178121270 21:29472841-29472863 ATACTGCAGCAGGCCAGGCGCGG - Intronic
1178493810 21:33070791-33070813 GGCCAGCAGCAGGCGCGGCGCGG - Exonic
1178839905 21:36130148-36130170 CGGCTGAACCAGCCCCGGCTGGG + Intergenic
1179295719 21:40060552-40060574 CTGGTGAAGCAGGCCCGGGGTGG + Intronic
1179475317 21:41639515-41639537 CGGAGGCAGCAGGCCTGGGGTGG - Intergenic
1179626546 21:42652695-42652717 CGGCTCCAGCAGGCCCGAAGGGG + Intergenic
1180062547 21:45393096-45393118 CGCCTGCAGCAGGCCCGCAGGGG + Intergenic
1180160976 21:45998600-45998622 CGGCTCCTGCAGGCCCTGCGAGG + Intronic
1180796728 22:18609435-18609457 CTGCTGCAGCAGGCGGCGCGCGG - Exonic
1181224996 22:21385836-21385858 CTGCTGCAGCAGGCGGCGCGCGG + Exonic
1181253636 22:21548977-21548999 CTGCTGCAGCAGGCGGCGCGCGG - Exonic
1181725132 22:24806229-24806251 CTGCTGCTGCAGCCGCGGCGGGG - Intronic
1181725136 22:24806237-24806259 CGGCTGCAGCAGCAGCGCCGCGG + Intronic
1182184298 22:28385984-28386006 AGGCTTCACCAGGCCGGGCGCGG + Intronic
1183384315 22:37506205-37506227 CAGCTGCAGCGGGCCCAGGGTGG - Exonic
1183404359 22:37623174-37623196 GGGCTCCAGCAGGCCCTGCCAGG - Intronic
1184035883 22:41917878-41917900 CATCTGCAGCAAGCCCCGCGGGG + Intergenic
1184292675 22:43506432-43506454 AGGCTGCAGCAGGCCTGCCATGG + Exonic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1185062985 22:48616714-48616736 GGGCTGCAGAAAGCCCAGCGAGG + Intronic
949810538 3:8001923-8001945 AGGCTGGAGCAGGCCCGGGCGGG + Intergenic
950168064 3:10816343-10816365 CGGCTGCAGCAGCGGGGGCGCGG + Exonic
950316406 3:12004970-12004992 CGGCAGCCGCAGGCCAGGAGAGG + Intronic
950743026 3:15064865-15064887 CGACTGCAGCCGGCCCGGCGGGG + Intronic
951567000 3:24020503-24020525 CAGCTGCAGCAGGGGAGGCGCGG - Intergenic
953564780 3:44022107-44022129 CGGATGCAGGAGGCCGGCCGAGG - Intergenic
954058998 3:48054333-48054355 CAGCTGGAGCAGGCCAGGCACGG + Intronic
954121411 3:48502349-48502371 CACCTGCTGCAGGCCCAGCGCGG - Intronic
954146253 3:48635703-48635725 CGACTGCGGCCAGCCCGGCGCGG - Intergenic
954256518 3:49411559-49411581 GGGCTCCACCAGGCCCGGCCGGG + Intronic
956678028 3:71753682-71753704 CGGCGGCGGCGGGCCCGGCGGGG + Intronic
957048726 3:75395967-75395989 GGGCTGCAGAGGGCCCAGCGCGG - Intergenic
968202172 3:196764090-196764112 AAGCAGCAGCAGGCCGGGCGCGG - Intronic
968485524 4:859179-859201 CGTCTGCCTCAGGCCCGGCCCGG - Intronic
968502855 4:959231-959253 AGGCTGCAGCAGGCTGGGCCAGG + Exonic
969108722 4:4828168-4828190 AGGCTGCAGCAGGCAGGGCGGGG - Intergenic
969344784 4:6563793-6563815 CGGCTGCGGGGGGCCGGGCGCGG + Intergenic
970456269 4:16226733-16226755 CGGCTGCATGGAGCCCGGCGCGG - Intronic
970585706 4:17512164-17512186 CGGCAGCAGCGGGCGCGGAGCGG - Exonic
973050189 4:45586417-45586439 CGACTACAGCTGGCCAGGCGCGG + Intergenic
975801101 4:78059213-78059235 GGGCTGCGGGAGGCCCGGGGAGG + Intronic
977862560 4:101982079-101982101 CAGCTGCAGCAGACCCAGGGAGG - Intronic
978723902 4:111947614-111947636 GGGCTGCTCCAGGCCGGGCGCGG + Intergenic
979010669 4:115365328-115365350 TGGCTGCAGCAGGGGCGGTGTGG + Intergenic
980445303 4:132898448-132898470 TGGCTGGAGGAGGCCGGGCGCGG + Intergenic
981315670 4:143337329-143337351 CGGCTGCAGCTGGCCGCGCGCGG + Intronic
981889331 4:149716601-149716623 CGGCTGCAGCCGGGCAGGCTTGG - Intergenic
982856345 4:160386240-160386262 CGGCTGCAGCAGGCGAGGTGTGG - Intergenic
985110740 4:186544307-186544329 TGGCTGCTGCAGGCCGGGCATGG - Intronic
985495233 5:200416-200438 CCGCTGGAGCAGGCCAGGCAGGG + Exonic
985628953 5:1005022-1005044 CGGCCGCAGGACGCCCAGCGGGG - Intergenic
986400382 5:7373194-7373216 CAGCTGTATCAGGCCAGGCGTGG + Intergenic
987050430 5:14143635-14143657 CGGCGCCGCCAGGCCCGGCGCGG + Intergenic
988264053 5:28927856-28927878 GGGCTGCAGAGGGCCCAGCGCGG - Intergenic
989710381 5:44389650-44389672 CGGCCGCAACAGCCGCGGCGAGG - Intronic
990041565 5:51383441-51383463 CGGCGGCGGCAGACTCGGCGCGG - Exonic
990678505 5:58215610-58215632 CAGCTGCAGCAGGGCCAGCCAGG - Intergenic
992374414 5:76174289-76174311 CGGCAGCGGCAGGACCGCCGTGG - Intronic
996785058 5:127229348-127229370 CGGCTGCGGCGGGCCCGGGCGGG - Intergenic
997013532 5:129905151-129905173 CCGCTGCAGCAGCGGCGGCGAGG + Exonic
997975413 5:138439077-138439099 CCGCTGCAGCAGCCGCCGCGGGG - Exonic
998143110 5:139710851-139710873 CGCCTGCAGCCGGCGAGGCGCGG + Intergenic
998218105 5:140252825-140252847 CGGCTGCAGCAGGCAGGGGCAGG + Intronic
999144255 5:149382015-149382037 CCTCTGCAGCAGGCCCCGCCAGG + Intronic
999188898 5:149731878-149731900 CGTCTGCAGCGGGCCAGGGGCGG - Intronic
999727234 5:154446646-154446668 CGGCGGCAGCTGGGGCGGCGGGG - Exonic
1001822978 5:174724489-174724511 CGTCAGCGCCAGGCCCGGCGCGG + Intergenic
1002021192 5:176365477-176365499 CGGCCGCAGCAGTCGCAGCGGGG + Exonic
1002065314 5:176648682-176648704 TGGCTGTAGCAGGCCTGGCTGGG + Intronic
1002432944 5:179213573-179213595 CAGGTGCAGCAGGGCCGGAGGGG + Intronic
1006640432 6:35486620-35486642 CGCCAGCAGCAGCCCCGGGGAGG - Exonic
1007680312 6:43629111-43629133 CGGCTGCTGCCGGCCCGGAGGGG - Exonic
1007767610 6:44170169-44170191 AGGCTGCAGCAGGCAGGGAGTGG - Intronic
1014111081 6:117619079-117619101 GGGCTGCAGCATGCCCTGGGTGG + Intergenic
1016400789 6:143677990-143678012 CGGCTGCGGCCGGCCGGGCTGGG + Exonic
1017672273 6:156778826-156778848 GGGCTACAGCCGGCCCGGCGCGG + Exonic
1018273417 6:162104629-162104651 CTGCATCAGCAGGCCAGGCGTGG + Intronic
1018470907 6:164097046-164097068 CAGCAGCAACAGGCCGGGCGCGG - Intergenic
1019061863 6:169262880-169262902 CGGGTGCAGGAGGCTCGGAGGGG - Intergenic
1019061880 6:169262936-169262958 CGGGTGCAGGAGGCTCGGAGGGG - Intergenic
1019061898 6:169262993-169263015 CGGGTGCAGGAGGCTCGGAGGGG - Intergenic
1019061914 6:169263049-169263071 CGGGTGCAGGAGGCTCGGAGGGG - Intergenic
1019061932 6:169263106-169263128 CGGGTGCAGGAGGCTCGGAGGGG - Intergenic
1019061948 6:169263162-169263184 CGGGTGCAGGAGGCTCGGAGGGG - Intergenic
1019551325 7:1604020-1604042 CGGCTGCAGCAGGTGCTGCCAGG + Intergenic
1019681853 7:2354971-2354993 CGGCTGCTGCTGGCCGGGCTCGG - Exonic
1021450418 7:20778661-20778683 CGGCAGCCCCAGGCCGGGCGCGG + Intergenic
1022018503 7:26376448-26376470 CGTCTGCAGCAGGTGCGGCCGGG - Intergenic
1023418260 7:39951233-39951255 CTGCTGCGGCGGTCCCGGCGGGG - Exonic
1025619768 7:63157887-63157909 AGGCTGAGGCAGGCCAGGCGTGG + Intergenic
1025959078 7:66205063-66205085 CGGCAGCCGCAGGCCTGGCCGGG - Intergenic
1026715904 7:72789119-72789141 CGTCTGCACCAGGCCGGGCTTGG - Intronic
1027123999 7:75542919-75542941 CAGCTGCAGCAGGCCTCTCGGGG - Exonic
1027211287 7:76150605-76150627 CGGCTGCATGAAGCCCGGCATGG + Intergenic
1027247237 7:76375457-76375479 CTGCTGCAGAAAGCCCAGCGGGG + Intergenic
1028567245 7:92246360-92246382 CGGGTGCACCCGGGCCGGCGAGG + Exonic
1029124790 7:98288355-98288377 CGACTGCAGCACGCCCTGCCTGG - Intronic
1029403278 7:100358325-100358347 CGGCTGCAGCAGGAGCAGCAGGG - Exonic
1029582678 7:101447806-101447828 GGGCTGCAGGGGGCCAGGCGTGG + Intronic
1031966491 7:128031406-128031428 CAGCTGCCGCCGGCCCGGAGCGG - Intronic
1032087338 7:128891058-128891080 CGGCTGCCCACGGCCCGGCGCGG - Exonic
1032194564 7:129781519-129781541 CGGCTTCAGCAGGCCCTGCCCGG - Intergenic
1032388512 7:131540702-131540724 CGGCTGCAGGAGGCCGGAGGTGG - Intronic
1033171803 7:139091207-139091229 CCCCTCCAGCAGGCCAGGCGCGG + Intronic
1035266493 7:157692673-157692695 GGGCTGCAGGAGGCCCGGTGCGG + Intronic
1036397924 8:8384728-8384750 CTGCTGCACCAGGCAAGGCGAGG - Intronic
1037803590 8:22048073-22048095 CGGCTGCGGGAAGCCTGGCGGGG - Exonic
1037882896 8:22581514-22581536 CGGCTGCAGCTGGACCGGTAGGG + Exonic
1039773825 8:40716264-40716286 CTGATGCAGCAGGTCTGGCGAGG - Intronic
1039951988 8:42179972-42179994 CGGCAGCTGCAGGTCCGCCGGGG + Exonic
1040776412 8:51048950-51048972 CACCTGCAGCAGGCCTGGCGAGG + Intergenic
1041109404 8:54470524-54470546 CGGCGTCAGCTGCCCCGGCGCGG - Intergenic
1042183406 8:66113759-66113781 CGGCTCCAGGGGGCCAGGCGGGG + Intergenic
1044715100 8:95092871-95092893 AGGCTTCAGCAGGCCGGGAGCGG - Intronic
1044873899 8:96645485-96645507 AGGCTGGAGCAGGCCAGGGGCGG + Intronic
1049897010 9:117938-117960 GGGCTGCAGGTGGCCCGGTGGGG - Exonic
1053715502 9:40884380-40884402 GGGCTGCAGAGGGCCCAGCGTGG - Intergenic
1053740110 9:41128190-41128212 GGGCTGCAGGTGGCCCGGTGGGG - Exonic
1054077042 9:60546357-60546379 GGGCTGCAGAGGGCCCAGCGTGG + Intergenic
1054443074 9:65284184-65284206 GGGCTGCAGGTGGCCCGGTGGGG - Exonic
1054487207 9:65737317-65737339 GGGCTGCAGGTGGCCCGGTGGGG + Exonic
1054688240 9:68303123-68303145 GGGCTGCAGGTGGCCCGGTGGGG + Exonic
1057328064 9:94084627-94084649 CGGCTGCAGCAGGCCCGGCGGGG + Exonic
1057740775 9:97709550-97709572 CGGCTGCAGCAGGCCCAGTGAGG + Intergenic
1059398594 9:114054575-114054597 GGGCTGGAGCAGGGCTGGCGGGG - Exonic
1060052622 9:120388068-120388090 AGGGTGCAGCAGCCCCGGCTGGG - Intergenic
1061320320 9:129824047-129824069 CAGCAGCAGCAGGCCCAGCACGG + Exonic
1061482066 9:130902288-130902310 TGGCTGGAGCAGGCCAGGTGCGG - Intergenic
1061488005 9:130930041-130930063 CGGCCGCTGCAGGCCCGCCCGGG + Exonic
1061811346 9:133164111-133164133 AGGATGCAGCAGGCCCAGCTCGG + Intergenic
1061991068 9:134159069-134159091 GGGCTCCAGCAGGGACGGCGAGG - Exonic
1062028219 9:134350308-134350330 AGGCTGCAGCTGGCGAGGCGGGG - Intronic
1062082292 9:134630479-134630501 CGGCTGCGGCAGGCCAAGAGTGG - Intergenic
1062276658 9:135734526-135734548 CGGCTGCAGCAGGTGCCGCCTGG - Intronic
1062443727 9:136584668-136584690 CGGCTCCAGCCTGCCCGGGGAGG - Intergenic
1062532204 9:137006946-137006968 AGGCTGCTGCAGGCCCCACGTGG + Intergenic
1062579069 9:137221670-137221692 TGGCTGCAGGAGGACCGGGGCGG + Intergenic
1062710970 9:137975018-137975040 AGGCAGCAGGAGGCCCAGCGAGG - Intronic
1186477059 X:9865848-9865870 AGGCAGCAGGAGGCCAGGCGCGG - Intronic
1189310040 X:40012490-40012512 CGGCTGCGGCCGGCGCGGCGCGG + Intergenic
1189534713 X:41923868-41923890 CGGCTGCAGCTGCCGAGGCGGGG + Intergenic
1190758599 X:53422135-53422157 CGGCTCCGGCCGGTCCGGCGGGG + Intronic
1190837397 X:54113619-54113641 TGCCTGCACCAGGCCGGGCGCGG + Intronic
1195349076 X:103979981-103980003 GGGCTGCAGCAGCCCAGGCTGGG - Intergenic
1195351057 X:103997338-103997360 GGGCTGCAGCAGCCCAGGCTTGG + Intergenic
1195352650 X:104009488-104009510 GGGCTGCAGCAGCCCAGGCTGGG + Intergenic
1195356444 X:104044074-104044096 GGGCTGCAGCAGCCCAGGCTGGG - Intergenic
1195358367 X:104058858-104058880 GGGCTGCAGCAGCCCAGGCTGGG + Intergenic
1195689957 X:107616362-107616384 TGCCTGCAGAAGGCCGGGCGCGG + Intergenic
1195803306 X:108735957-108735979 CTGCTGCAGCCGCCGCGGCGCGG + Exonic
1197706632 X:129639067-129639089 CGGCCTCAGCAGGACCTGCGAGG - Intergenic
1198233583 X:134716022-134716044 GGGCAGCAGCAGGCCCAGCTGGG + Intronic
1200100494 X:153687538-153687560 CGGCTGCAGCCTGCCAGGAGCGG + Intronic
1200234403 X:154461344-154461366 CGGCTGCTCCTGGCGCGGCGTGG + Exonic
1200235125 X:154464382-154464404 CCCCTGCAGCAGTCCCGGGGTGG - Exonic