ID: 1057331411

View in Genome Browser
Species Human (GRCh38)
Location 9:94119185-94119207
Sequence CAGCGCGATTCCGTGGGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057331407_1057331411 16 Left 1057331407 9:94119146-94119168 CCGCCTTGCAGTTTGATCTCAGA 0: 2869
1: 1007
2: 456
3: 293
4: 360
Right 1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1057331404_1057331411 29 Left 1057331404 9:94119133-94119155 CCCAGCCTCGTTGCCGCCTTGCA 0: 317
1: 1173
2: 1908
3: 1654
4: 702
Right 1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1057331408_1057331411 13 Left 1057331408 9:94119149-94119171 CCTTGCAGTTTGATCTCAGACTG 0: 3663
1: 1439
2: 732
3: 491
4: 588
Right 1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1057331403_1057331411 30 Left 1057331403 9:94119132-94119154 CCCCAGCCTCGTTGCCGCCTTGC 0: 316
1: 1145
2: 1873
3: 1683
4: 815
Right 1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1057331406_1057331411 24 Left 1057331406 9:94119138-94119160 CCTCGTTGCCGCCTTGCAGTTTG 0: 317
1: 1166
2: 1768
3: 1553
4: 836
Right 1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831
1057331405_1057331411 28 Left 1057331405 9:94119134-94119156 CCAGCCTCGTTGCCGCCTTGCAG 0: 315
1: 1152
2: 1845
3: 1595
4: 741
Right 1057331411 9:94119185-94119207 CAGCGCGATTCCGTGGGCGTAGG 0: 16
1: 450
2: 786
3: 859
4: 831

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057331411 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG Intergenic
Too many off-targets to display for this crispr