ID: 1057337334

View in Genome Browser
Species Human (GRCh38)
Location 9:94166285-94166307
Sequence CCGCGCCAGGACCCGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 88}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057337334_1057337340 -3 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337340 9:94166305-94166327 CGGTGCTCTCCCGGCAGCGACGG 0: 1
1: 0
2: 0
3: 6
4: 58
1057337334_1057337348 12 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337348 9:94166320-94166342 AGCGACGGGCGCGAGGGCCGGGG 0: 1
1: 0
2: 0
3: 16
4: 166
1057337334_1057337341 -2 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337341 9:94166306-94166328 GGTGCTCTCCCGGCAGCGACGGG 0: 1
1: 0
2: 0
3: 0
4: 91
1057337334_1057337342 5 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337342 9:94166313-94166335 TCCCGGCAGCGACGGGCGCGAGG 0: 1
1: 0
2: 2
3: 11
4: 110
1057337334_1057337349 23 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337349 9:94166331-94166353 CGAGGGCCGGGGCATTCCCACGG 0: 1
1: 0
2: 0
3: 18
4: 108
1057337334_1057337346 10 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337346 9:94166318-94166340 GCAGCGACGGGCGCGAGGGCCGG 0: 1
1: 0
2: 0
3: 11
4: 237
1057337334_1057337347 11 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337347 9:94166319-94166341 CAGCGACGGGCGCGAGGGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 154
1057337334_1057337344 6 Left 1057337334 9:94166285-94166307 CCTCCATCCGGGTCCTGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1057337344 9:94166314-94166336 CCCGGCAGCGACGGGCGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057337334 Original CRISPR CCGCGCCAGGACCCGGATGG AGG (reversed) Intergenic
900091633 1:923314-923336 CCGCGCCAGGACCATGGTGTGGG - Intergenic
900405322 1:2490416-2490438 CCCCGCCAGGGCCAGGGTGGGGG + Intronic
901879064 1:12183278-12183300 CCATGCCAGGGCCAGGATGGCGG - Intronic
902690603 1:18108175-18108197 GCGCGCCAGGTCCAGGATCGCGG - Exonic
905416700 1:37808706-37808728 CGGCGCCCGGAGCCGGCTGGTGG + Exonic
905796304 1:40818443-40818465 CCGCGCACGGACCCGGAGGCGGG - Intronic
912817791 1:112843480-112843502 CCGCGCCCGGCCCCAGATTGGGG - Intergenic
922721704 1:227903175-227903197 ACTAGCCAGGCCCCGGATGGTGG + Intergenic
1067214700 10:44292857-44292879 CCGCGCCAGGACTCGGCCGCAGG + Exonic
1068538542 10:58267570-58267592 CGGCGCCTCGACCCGGAGGGGGG + Exonic
1069677051 10:70255740-70255762 CAGCGCCAGGGCCCAGATGACGG + Exonic
1069942467 10:71964761-71964783 GCGCGCCTGGACGCGGAAGGCGG - Intronic
1072634019 10:97165772-97165794 TGGCCCCAGGACCCAGATGGTGG - Intronic
1074483596 10:113852044-113852066 CCGCGCCCGGCCCCAGTTGGTGG - Intronic
1078594347 11:12674173-12674195 CCGCGCCGGGAGACGGAGGGCGG + Intergenic
1083844637 11:65324029-65324051 CCACGCCAGGTCGGGGATGGAGG + Intergenic
1084937892 11:72596704-72596726 CCGAGCCGGGACCCAGGTGGGGG + Intronic
1089289417 11:117428685-117428707 TCGAGCCAGGTTCCGGATGGAGG + Exonic
1101967454 12:109291283-109291305 TCACGACAGGGCCCGGATGGTGG - Intronic
1105000664 12:132687869-132687891 CCGGGCCGGGACCAGGCTGGGGG + Intronic
1105373104 13:19818332-19818354 CAGCGCCAGGACGAGGATCGCGG + Intergenic
1105538961 13:21298117-21298139 CCGCGCCCAGACCCGGAGGCGGG + Intergenic
1105799285 13:23889434-23889456 CCGCGCCCAGACCCGGAAGCGGG - Intergenic
1116817675 14:49598934-49598956 GTGCGCGAGGACCCCGATGGCGG + Exonic
1126775706 15:52098983-52099005 CCGCGCCAGGCCCCGGCTTTGGG - Intergenic
1127144079 15:56007181-56007203 GCGCGCCAGGATCCGGGCGGCGG + Intergenic
1128315107 15:66655121-66655143 CCGGGCCGGGAGCCGGGTGGGGG - Intronic
1129286925 15:74532968-74532990 CTGAGGCAGGACCCGGAAGGTGG + Intergenic
1132607802 16:800784-800806 CGGCGCCAGGGCCCAGGTGGCGG - Intergenic
1132675422 16:1119356-1119378 CCGCGCCGGGGCCTGGAGGGAGG - Intergenic
1138504458 16:57470878-57470900 CAGAGCCAAGACCCGGAAGGAGG + Intronic
1140096980 16:71883868-71883890 CCCAGCCCGGACCCGGAGGGAGG + Intronic
1141625681 16:85259853-85259875 CCGTGCCAGCATCCAGATGGGGG + Intergenic
1142127641 16:88418123-88418145 CCCTGCCAGGCCCAGGATGGGGG + Intergenic
1142207258 16:88789754-88789776 CCGCGCCAGCACGGGGCTGGGGG + Intergenic
1142211699 16:88811593-88811615 TCGCGCCAGGAGGCCGATGGCGG + Exonic
1147248730 17:39139700-39139722 CTGAGCCAGGACCTGGGTGGGGG - Exonic
1151757967 17:76085529-76085551 CCACCCCAGGACCCGGAAGGTGG - Intronic
1152039702 17:77894781-77894803 CTGCGCCAGGAGCAGGAGGGAGG + Intergenic
1156471787 18:37381643-37381665 CCAGGCCAGGACTCGGATGCTGG + Intronic
1160533367 18:79578042-79578064 CCGTGGCAGGACCAGGAAGGAGG + Intergenic
1162289523 19:9768521-9768543 CCCCGCCAGGACCCCGAGGCGGG - Exonic
1162954132 19:14089142-14089164 CCGCACCAGGGCCAGGATGAAGG - Exonic
1165334092 19:35156923-35156945 CAGAGGCAGGACCAGGATGGGGG + Intronic
1165419910 19:35717661-35717683 CCCGGCCAGGACCCGGAAAGCGG - Intergenic
1165795599 19:38517395-38517417 CCGCTCCAGCACCGGGATGTCGG - Exonic
1167007999 19:46787891-46787913 CAGCGCCAGGCCCCCGTTGGCGG + Exonic
1167592928 19:50414159-50414181 CCACGCAGGGACCCTGATGGGGG + Intronic
1168686965 19:58354677-58354699 CAGAGCCAGTACCTGGATGGAGG + Exonic
931261144 2:60620399-60620421 CCCCGCCAACACCCTGATGGTGG + Intergenic
936572321 2:113627210-113627232 CCGCGCAAGGACCCCGAGGGAGG - Exonic
948066823 2:235087323-235087345 CCCCGCCAGGAACAGCATGGTGG - Intergenic
1172903378 20:38350894-38350916 CCTGCCCTGGACCCGGATGGAGG - Exonic
1181641506 22:24202518-24202540 CCGCGCCTGGCCCCGAATGCGGG - Intergenic
1182485316 22:30635613-30635635 CCGCCCCCGGACCGGGAGGGCGG - Intergenic
1183606013 22:38867023-38867045 CCCCGCCCGGACCCGCAGGGGGG - Exonic
1183933892 22:41250850-41250872 CCACGGCAGGACCCTGACGGAGG + Intronic
1184166613 22:42732885-42732907 CCGCGCCCAGACCCAAATGGAGG - Intergenic
1185427867 22:50783670-50783692 CCGCACAAGGACCCCGAGGGAGG + Intergenic
953344016 3:42160149-42160171 CCCGGGCAGGACCCGGAAGGGGG - Intronic
953929465 3:46998767-46998789 CCTCGCCAGGCCCAGGAGGGAGG - Exonic
965828111 3:172751021-172751043 CCGCGTCAGGGCCCGGCTGCTGG - Intronic
968647449 4:1747796-1747818 ACCCGCCAGCACCCTGATGGCGG + Intergenic
968905355 4:3448292-3448314 CCCCACCAGGACCCGACTGGTGG + Intronic
969710624 4:8840993-8841015 CCCCGCCAGGGCCTGGATGAGGG + Intergenic
969722666 4:8901167-8901189 CCGCCCCAGGAGCCGGAGCGAGG - Intergenic
971308780 4:25506270-25506292 CAGCGCCAGGTCCAGGATGATGG - Intergenic
979590925 4:122479655-122479677 CCGCTCCATGATCCAGATGGAGG + Intergenic
985733432 5:1564129-1564151 CTGTGCCAGGACCCAGAGGGTGG - Intergenic
985995848 5:3596422-3596444 CCGCGCCAGGGCAAGGGTGGCGG + Intronic
996298528 5:121954069-121954091 CCGCGCCCTGACCCGCAGGGAGG + Intergenic
997206387 5:132052654-132052676 CCAGGCCTGGACCAGGATGGGGG + Intergenic
997239182 5:132294362-132294384 CCGCGCCCGGCCGGGGATGGGGG + Intronic
997470229 5:134113422-134113444 CTGGGCCTGGACCCGGAGGGAGG + Intergenic
999230611 5:150059745-150059767 CCCGGCCAGGACCCCGAGGGAGG - Exonic
1001277182 5:170359478-170359500 GCGAGCCAGGACTCGGATGGTGG - Intronic
1001906557 5:175478448-175478470 CCGGGCCTGGACCCGGAGGGCGG + Exonic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006665233 6:35688720-35688742 CCGCGGCGGGACCTGGAAGGAGG + Intronic
1007589719 6:43013856-43013878 CGGCGCCGGGATTCGGATGGGGG - Exonic
1007718144 6:43869338-43869360 CCGAGCCAGGACCCCAAAGGAGG - Intergenic
1007780128 6:44247858-44247880 CCGCCCCAGTGCCCGGATGCTGG + Exonic
1018953667 6:168394174-168394196 CAGGGCCTGGACCCGAATGGAGG - Intergenic
1019297988 7:289363-289385 CCCCGCCAGGGCCCGGAGGGAGG - Intergenic
1019476355 7:1246546-1246568 CCGCCCCAGGACCGGACTGGTGG - Intergenic
1021716839 7:23469251-23469273 CCGCGCCAGGGCCCGGAGAGCGG + Intronic
1033406085 7:141072864-141072886 GCGCGCCGGGAGCCGGATCGTGG + Intergenic
1035478212 7:159158801-159158823 CCGCACCAGCACCCGGTGGGAGG - Intergenic
1041326002 8:56665094-56665116 CCGCGCCCGGCCCAGGGTGGTGG + Intergenic
1044242514 8:89902907-89902929 CCGGGCCGGGACCGGGGTGGAGG + Intronic
1057337334 9:94166285-94166307 CCGCGCCAGGACCCGGATGGAGG - Intergenic
1061034714 9:128107151-128107173 CCTAGTCAGGACCCGGATGCAGG + Exonic
1061391776 9:130320803-130320825 CCCCTCCAGGACCCGGACGGTGG - Intronic
1061513805 9:131076809-131076831 CCGAGCCAGGACCAGGACCGGGG + Intronic
1199607100 X:149586110-149586132 CAGGGCCAGGACCCTGAGGGAGG - Intronic
1199632022 X:149783258-149783280 CAGGGCCAGGACCCTGAGGGAGG + Intronic