ID: 1057337551

View in Genome Browser
Species Human (GRCh38)
Location 9:94166998-94167020
Sequence AGGGAGGCTGCACTTGGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057337551_1057337556 -3 Left 1057337551 9:94166998-94167020 CCGCGGCCAAGTGCAGCCTCCCT No data
Right 1057337556 9:94167018-94167040 CCTTCCTGAAGCAGCTGCTGCGG No data
1057337551_1057337558 1 Left 1057337551 9:94166998-94167020 CCGCGGCCAAGTGCAGCCTCCCT No data
Right 1057337558 9:94167022-94167044 CCTGAAGCAGCTGCTGCGGCTGG No data
1057337551_1057337561 27 Left 1057337551 9:94166998-94167020 CCGCGGCCAAGTGCAGCCTCCCT No data
Right 1057337561 9:94167048-94167070 TCCGCTGCGGCAGCCGTCCTTGG No data
1057337551_1057337559 4 Left 1057337551 9:94166998-94167020 CCGCGGCCAAGTGCAGCCTCCCT No data
Right 1057337559 9:94167025-94167047 GAAGCAGCTGCTGCGGCTGGAGG No data
1057337551_1057337560 14 Left 1057337551 9:94166998-94167020 CCGCGGCCAAGTGCAGCCTCCCT No data
Right 1057337560 9:94167035-94167057 CTGCGGCTGGAGGTCCGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057337551 Original CRISPR AGGGAGGCTGCACTTGGCCG CGG (reversed) Intergenic
No off target data available for this crispr