ID: 1057339703

View in Genome Browser
Species Human (GRCh38)
Location 9:94188963-94188985
Sequence TCAGGTCAAAACTCAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057339702_1057339703 -10 Left 1057339702 9:94188950-94188972 CCTTAGGGAATTGTCAGGTCAAA No data
Right 1057339703 9:94188963-94188985 TCAGGTCAAAACTCAGAGCCAGG No data
1057339699_1057339703 -4 Left 1057339699 9:94188944-94188966 CCAGTCCCTTAGGGAATTGTCAG No data
Right 1057339703 9:94188963-94188985 TCAGGTCAAAACTCAGAGCCAGG No data
1057339701_1057339703 -9 Left 1057339701 9:94188949-94188971 CCCTTAGGGAATTGTCAGGTCAA No data
Right 1057339703 9:94188963-94188985 TCAGGTCAAAACTCAGAGCCAGG No data
1057339698_1057339703 4 Left 1057339698 9:94188936-94188958 CCTATGCACCAGTCCCTTAGGGA No data
Right 1057339703 9:94188963-94188985 TCAGGTCAAAACTCAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057339703 Original CRISPR TCAGGTCAAAACTCAGAGCC AGG Intergenic
No off target data available for this crispr