ID: 1057350465

View in Genome Browser
Species Human (GRCh38)
Location 9:94292997-94293019
Sequence CTCATCGAACAGCTGGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057350459_1057350465 26 Left 1057350459 9:94292948-94292970 CCTTGGTTTTTTTTTCCTGTGAG 0: 1
1: 0
2: 7
3: 100
4: 1017
Right 1057350465 9:94292997-94293019 CTCATCGAACAGCTGGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1057350461_1057350465 11 Left 1057350461 9:94292963-94292985 CCTGTGAGTAGGAATTGCATTTT 0: 1
1: 0
2: 2
3: 17
4: 227
Right 1057350465 9:94292997-94293019 CTCATCGAACAGCTGGAGCAAGG 0: 1
1: 0
2: 0
3: 8
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057350465 Original CRISPR CTCATCGAACAGCTGGAGCA AGG Exonic
902556090 1:17247625-17247647 CTCCTGGAAGAGCAGGAGCAAGG - Intergenic
905403328 1:37718075-37718097 CTCAGAGAAAAGCTGGGGCAGGG - Exonic
912184319 1:107256668-107256690 CTCATGGAACTACTGGAGCAAGG - Intronic
913486599 1:119337315-119337337 CTGATAGGTCAGCTGGAGCATGG - Intergenic
915197331 1:154199493-154199515 CTTTTCAAACAGCTGGTGCAGGG + Exonic
1067010662 10:42709879-42709901 ATAATCGAATAGCTGGAGTAAGG - Intergenic
1067312846 10:45131319-45131341 ATAATCGAATAGCTGGAGTAAGG + Intergenic
1068299384 10:55118993-55119015 CCCATTGAACAGAGGGAGCATGG - Intronic
1071086647 10:81874627-81874649 AGCAGCGAACGGCTGGAGCAAGG + Intergenic
1072189500 10:93068528-93068550 CACAGCTAGCAGCTGGAGCACGG - Exonic
1073642381 10:105265977-105265999 TGCATCGAACAGCTGGAAGAAGG - Intergenic
1073801627 10:107047722-107047744 TTCAGGGAACAACTGGAGCAGGG - Intronic
1081794623 11:45810971-45810993 CTCCCCGAGCAGCAGGAGCAGGG - Exonic
1088823140 11:113473782-113473804 CTCATCAAACAGCTGCATGAGGG + Intronic
1091604455 12:1938054-1938076 CTCTCCCAACAACTGGAGCATGG + Intergenic
1099955802 12:89351951-89351973 CTCAACGAGCAGCTGGAGCTGGG - Exonic
1100585765 12:95977943-95977965 GTCATCGAGCATGTGGAGCAAGG - Exonic
1102887124 12:116530603-116530625 CTCATCTAAAAGATGGAGCTAGG + Intergenic
1109122439 13:58474794-58474816 ATCATCAAACAGCTGGAAGATGG - Intergenic
1112186517 13:97133255-97133277 CTCATCCAGCAGCTTGACCAAGG + Intergenic
1114531084 14:23396917-23396939 CTCATAGAACAGGGGGAGCCAGG - Intronic
1114536439 14:23425918-23425940 CTCATAGAACAGGGGGAGCCAGG - Intronic
1118395766 14:65335138-65335160 CTCCTTGAACAGGAGGAGCAAGG - Intergenic
1124246870 15:28078627-28078649 CTCAGTGTTCAGCTGGAGCAAGG - Intronic
1124369510 15:29095910-29095932 CTCCTAGTCCAGCTGGAGCAGGG + Intronic
1124621167 15:31274896-31274918 CTCCCAGAACAGCTGGAGAAGGG + Intergenic
1126841047 15:52717804-52717826 CTCATGGTAAAGCTGGACCAGGG + Intergenic
1129276365 15:74448352-74448374 TTCTAGGAACAGCTGGAGCATGG - Intronic
1131389791 15:92037747-92037769 CTGAATGAACTGCTGGAGCAAGG - Intronic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1135993020 16:27228948-27228970 CTCAGAGAGCAGCAGGAGCAGGG - Intronic
1137614274 16:49837608-49837630 CTCCTGGAAGGGCTGGAGCAGGG - Intronic
1152251609 17:79215473-79215495 CTCAAGGAACAGATGGAGAAAGG - Intronic
1157336050 18:46738357-46738379 CACATCCAACACCTGGTGCAGGG + Intronic
1158112152 18:53952136-53952158 CTCAGGGAACAGCTGGTGCTGGG + Intergenic
1161169261 19:2804880-2804902 CTCAGCGAGCAGCTGCAGCCTGG - Intronic
1163527381 19:17830145-17830167 CTCTTGGAACTGCTGGAGGAGGG - Exonic
1163880485 19:19916583-19916605 CTGATCGCCCATCTGGAGCAAGG + Exonic
1163921975 19:20297854-20297876 CTCATCACCCATCTGGAGCAAGG + Intergenic
1163970914 19:20793806-20793828 CTCATCACCCATCTGGAGCAAGG + Exonic
1165636879 19:37347800-37347822 CTCATTGCTCAGCTGGAGCGAGG + Exonic
1166988550 19:46677204-46677226 TTCATGGAGCAGGTGGAGCAGGG - Intronic
1168677045 19:58286133-58286155 GTCATCTCCCAGCTGGAGCAAGG + Exonic
928100015 2:28431426-28431448 TGCATAGAACAGCTGGCGCATGG - Intergenic
929000393 2:37342743-37342765 GGCCTCCAACAGCTGGAGCAGGG - Intergenic
930614168 2:53576253-53576275 CACATCTGACAGCTGGAGAAAGG - Intronic
932844243 2:75119078-75119100 CTCATGGAACAGATGCAGCAGGG + Intronic
937668651 2:124515779-124515801 CACATGGTCCAGCTGGAGCAGGG + Intronic
938580025 2:132637429-132637451 TCCATCAAACAGCTGGAACAAGG + Intronic
939385028 2:141485246-141485268 CTCATGAGACAGCTGGATCATGG + Intronic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
940716341 2:157229267-157229289 TTCCTCAAACAACTGGAGCAAGG - Intergenic
940894659 2:159069252-159069274 CTGATGGAACAGCAGGAACAAGG - Intronic
1168850072 20:970290-970312 CTCATCCGAGAGCTGGAGCAGGG - Intronic
1170657842 20:18306321-18306343 CTCATCACCCAGCTGGAGCAAGG + Exonic
1173705336 20:45106197-45106219 CTCACAGAACTGCTGGAACAGGG + Intergenic
1183013357 22:34965869-34965891 CTCATCAAACATCTAGAGCATGG - Intergenic
1185379864 22:50503410-50503432 GTCCTCGAACTACTGGAGCAGGG + Exonic
953155798 3:40372114-40372136 CTCCTCCAAGAGCTGGAGGATGG - Intergenic
954711262 3:52506159-52506181 CTCAACGGTCAGCTGGGGCAAGG - Exonic
961457369 3:127030895-127030917 CTCACGGAGCAGCTGGAGTACGG + Intronic
962250562 3:133833561-133833583 CTCATGGAGCTGCTGGGGCAGGG - Intronic
978068472 4:104436101-104436123 CTAAGCTAAGAGCTGGAGCATGG - Intergenic
986123717 5:4866706-4866728 CTCCACGAGCAGCTGGAGCCCGG - Intergenic
987313644 5:16703919-16703941 TTCCTCAAACAGCTGGAGGATGG + Intronic
995969562 5:117951951-117951973 CTCATGGAACATCTACAGCAAGG - Intergenic
995991678 5:118247414-118247436 GCCCTTGAACAGCTGGAGCACGG + Intergenic
996530700 5:124523883-124523905 ATCATAGAAAAACTGGAGCAAGG - Intergenic
998587643 5:143444188-143444210 CTCATAAGATAGCTGGAGCAAGG + Intergenic
1001703903 5:173728025-173728047 CTCATTAAACAGCTGCAGCTGGG + Intergenic
1003245662 6:4379890-4379912 CTCCCCGATCTGCTGGAGCATGG - Intergenic
1004051765 6:12088516-12088538 GTCAAAGAACAGCAGGAGCAAGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1016641827 6:146358530-146358552 CTCACAGCACAGCTGGAGCTGGG + Intronic
1018530324 6:164756218-164756240 CTCATCACTCAGCTGGTGCAGGG - Intergenic
1018702091 6:166435524-166435546 CTCAGCGAACAGCTGGTGTGTGG - Intronic
1018858095 6:167689741-167689763 CCCCTCGAAAAGCAGGAGCAGGG - Intergenic
1019934711 7:4246721-4246743 CTCACCAAGCAGCTGGACCAGGG + Intronic
1022817130 7:33924481-33924503 CACAGCGCGCAGCTGGAGCACGG - Intronic
1023924484 7:44656087-44656109 TTCATAGAACAGCTGGAATAAGG - Intronic
1025736963 7:64159203-64159225 CACATGGAAAAGTTGGAGCATGG - Intronic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1033153550 7:138937145-138937167 CACGTCGAATAGCTGGGGCATGG - Intronic
1034516662 7:151586139-151586161 CTCAGTCAACACCTGGAGCAAGG - Intronic
1036488527 8:9201962-9201984 CTGAATGAAGAGCTGGAGCAAGG - Intergenic
1039307714 8:36280908-36280930 CTCATTGAACAGCTGGAAAGAGG - Intergenic
1041043354 8:53868478-53868500 CTCATCGAATAGCTGGGGGCAGG + Intronic
1046285768 8:112091826-112091848 CTCAGGCAACAGCTGCAGCAAGG + Intergenic
1047505828 8:125479250-125479272 CTCATCTAACAGCTGGAGAGAGG - Intergenic
1048003466 8:130399121-130399143 CACATCTAACAGCAGGAGGAAGG - Intronic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1049186902 8:141260022-141260044 CTCATGAAACAGCATGAGCATGG + Intronic
1049668570 8:143859559-143859581 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049668986 8:143861161-143861183 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049669401 8:143862763-143862785 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049669812 8:143864356-143864378 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1049670228 8:143865964-143865986 CTCCTCGCTCAGCTGGTGCACGG + Exonic
1050287498 9:4118276-4118298 CGCATGCAACAGCTGGAGCACGG - Exonic
1052374610 9:27704661-27704683 CACATTAAACAGCTTGAGCAAGG + Intergenic
1052791312 9:32877784-32877806 GTCCTCTAACAGCTGGGGCATGG - Intergenic
1056488732 9:87084605-87084627 ATCATCGCACAGCTTCAGCAGGG - Intergenic
1057350465 9:94292997-94293019 CTCATCGAACAGCTGGAGCAAGG + Exonic
1060942259 9:127549806-127549828 CTCAGCGAGCAGCAGGTGCAGGG + Intronic
1186250877 X:7664837-7664859 CTAATAGAACAGCTTGAGCTTGG - Intergenic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1195107690 X:101616661-101616683 CTCTTCAATCAGGTGGAGCAAGG - Exonic