ID: 1057351744

View in Genome Browser
Species Human (GRCh38)
Location 9:94304416-94304438
Sequence CATTCGGTGCTGAAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057351744_1057351749 9 Left 1057351744 9:94304416-94304438 CCCTGTTCCTTCAGCACCGAATG No data
Right 1057351749 9:94304448-94304470 TGGTCAGTCTCCCCAGTGCTTGG No data
1057351744_1057351753 21 Left 1057351744 9:94304416-94304438 CCCTGTTCCTTCAGCACCGAATG No data
Right 1057351753 9:94304460-94304482 CCAGTGCTTGGAGCCACTGCTGG No data
1057351744_1057351754 29 Left 1057351744 9:94304416-94304438 CCCTGTTCCTTCAGCACCGAATG No data
Right 1057351754 9:94304468-94304490 TGGAGCCACTGCTGGCTCAGAGG No data
1057351744_1057351755 30 Left 1057351744 9:94304416-94304438 CCCTGTTCCTTCAGCACCGAATG No data
Right 1057351755 9:94304469-94304491 GGAGCCACTGCTGGCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057351744 Original CRISPR CATTCGGTGCTGAAGGAACA GGG (reversed) Intergenic
No off target data available for this crispr