ID: 1057352669

View in Genome Browser
Species Human (GRCh38)
Location 9:94313648-94313670
Sequence CTAAAAACATGGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057352666_1057352669 26 Left 1057352666 9:94313599-94313621 CCAATGGAATATTATTCAGCAAT No data
Right 1057352669 9:94313648-94313670 CTAAAAACATGGATGAAGCTTGG No data
1057352665_1057352669 29 Left 1057352665 9:94313596-94313618 CCACCAATGGAATATTATTCAGC No data
Right 1057352669 9:94313648-94313670 CTAAAAACATGGATGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057352669 Original CRISPR CTAAAAACATGGATGAAGCT TGG Intergenic
No off target data available for this crispr