ID: 1057352669 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:94313648-94313670 |
Sequence | CTAAAAACATGGATGAAGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1057352666_1057352669 | 26 | Left | 1057352666 | 9:94313599-94313621 | CCAATGGAATATTATTCAGCAAT | No data | ||
Right | 1057352669 | 9:94313648-94313670 | CTAAAAACATGGATGAAGCTTGG | No data | ||||
1057352665_1057352669 | 29 | Left | 1057352665 | 9:94313596-94313618 | CCACCAATGGAATATTATTCAGC | No data | ||
Right | 1057352669 | 9:94313648-94313670 | CTAAAAACATGGATGAAGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1057352669 | Original CRISPR | CTAAAAACATGGATGAAGCT TGG | Intergenic | ||
No off target data available for this crispr |