ID: 1057358022

View in Genome Browser
Species Human (GRCh38)
Location 9:94347659-94347681
Sequence AGCCGCGGCGAGCAAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 2, 1: 0, 2: 3, 3: 21, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057358015_1057358022 12 Left 1057358015 9:94347624-94347646 CCGGCGATAAAGCTGCCAGAGTC No data
Right 1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG 0: 2
1: 0
2: 3
3: 21
4: 140
1057358019_1057358022 -3 Left 1057358019 9:94347639-94347661 CCAGAGTCTGCGGCGGAGGCAGC No data
Right 1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG 0: 2
1: 0
2: 3
3: 21
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057358022 Original CRISPR AGCCGCGGCGAGCAAGGAGC TGG Intergenic
901316776 1:8315059-8315081 AGGCGCAGGGAGAAAGGAGCTGG + Intergenic
904080999 1:27872559-27872581 AGCCGCGGGGACCATGGAGCCGG + Exonic
905530345 1:38673568-38673590 ATCCCCAGCGAGCAAGGAGATGG + Intergenic
914134048 1:144883570-144883592 AGCCGGGGCGGGCAAAAAGCCGG + Intergenic
921024090 1:211260727-211260749 AGCCGCGGAGAGAAAGGGGTGGG + Intronic
922416579 1:225427911-225427933 CGCCGCGGGGAGCTGGGAGCAGG + Intronic
1064408855 10:15088447-15088469 AGCGCCGGGGAGCACGGAGCGGG - Intronic
1066956487 10:42177807-42177829 AGCCGCGGCGGGCAAAAAGCCGG - Intergenic
1068222862 10:54064945-54064967 AGCCGGTGGGAGCAAGGAGCAGG - Intronic
1069473876 10:68716307-68716329 AGCTTCGGCTAGCAAGGCGCTGG + Intergenic
1069876739 10:71567752-71567774 AGCAGCTGGGAGCAAGGAGAGGG - Intronic
1070954384 10:80454625-80454647 AGCCGCGGCGGGCCCGGGGCCGG + Intronic
1071086633 10:81874549-81874571 CGCCGCCGCGAGCCAGGGGCTGG - Intergenic
1076372159 10:129962912-129962934 AGGGGCGGCGAGCACGCAGCAGG + Intronic
1077288881 11:1779743-1779765 AGCCTAGGCGCACAAGGAGCAGG - Intergenic
1077305934 11:1868715-1868737 AGCCCAGGCGAGCCAGCAGCAGG + Intronic
1077865464 11:6218009-6218031 AGCCCTGGTGAGCAAGGGGCTGG + Exonic
1079714671 11:23730660-23730682 AGCCTCGCCAAGAAAGGAGCTGG - Intergenic
1080791409 11:35525576-35525598 AGCCGCGGCAAGGATGGAGCTGG - Exonic
1082985943 11:59171700-59171722 AGCCGGGGCAAGGAAGGAGTTGG + Intronic
1083617975 11:64035821-64035843 GGCGGCGGCGAGCAGGGCGCGGG - Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084527244 11:69704817-69704839 GGCCGGGGCGAGCGCGGAGCAGG - Intergenic
1089254179 11:117185481-117185503 AGCTGTGGTGAGCAAGGAACAGG + Intronic
1091616169 12:2052830-2052852 TGCGGCGGCGCGCAGGGAGCCGG - Intronic
1091915803 12:4271311-4271333 AGCGGGGGCGAGGAAGAAGCGGG - Intergenic
1098320654 12:69239956-69239978 AGCGCCGGCGAGGGAGGAGCCGG - Intronic
1101343463 12:103863730-103863752 AGCCTCAGTGAGCAAAGAGCAGG - Intergenic
1103377539 12:120469004-120469026 AGCCACGGCGAGCACGGGCCGGG + Intronic
1103958550 12:124593288-124593310 TGCCGGGGAGAGCAAGGAGCTGG - Intergenic
1105014182 12:132776184-132776206 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014213 12:132776343-132776365 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014230 12:132776420-132776442 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105014264 12:132776578-132776600 AGCAGCAGGGAGGAAGGAGCTGG - Intronic
1105037103 12:132933523-132933545 GGCTGCAGCGAGGAAGGAGCTGG - Intronic
1105510674 13:21049362-21049384 AGCCCCGGGGAGCAAGGGGAAGG + Intronic
1105745723 13:23375522-23375544 AGCCGCGGCGGCCGAGGAGCAGG + Intronic
1108576765 13:51797678-51797700 AGCCTCGGCCAGCAGGGAGCTGG - Intronic
1114736722 14:25049998-25050020 AGCGGCGGCGAGCCAGCACCCGG - Exonic
1115592210 14:34874959-34874981 GGCGGCGGCGGGCGAGGAGCCGG - Intronic
1121190643 14:92026466-92026488 GGCTGCGGCGAGCAAGGAGGCGG - Intronic
1121714388 14:96062611-96062633 AGCAGCCGTGAGCAGGGAGCTGG - Intronic
1121736999 14:96225676-96225698 AGCCGGGGAGAGCACTGAGCTGG - Intronic
1123216447 14:106813185-106813207 AGCCGGTGGGAGCCAGGAGCAGG + Intergenic
1123396703 15:19944204-19944226 AGCCGCGGCGGGCAAAAAGCCGG - Intergenic
1129644615 15:77419467-77419489 AGCCGCGGCGCGAAGGGAGCAGG + Intronic
1129956052 15:79637774-79637796 AGCCGCTGCTTGCCAGGAGCTGG - Intergenic
1133969806 16:10559371-10559393 AGCCACAGTGAGCATGGAGCTGG - Intronic
1134614860 16:15643202-15643224 AGGCGGGGCGAGGAAGGGGCGGG - Intergenic
1136136279 16:28258695-28258717 AGCTGGGGAGAGCAGGGAGCCGG + Intergenic
1136318027 16:29465581-29465603 AGCAGCTGCGAGGAAGGGGCTGG - Intronic
1136432602 16:30204930-30204952 AGCAGCTGCGAGGAAGGGGCTGG - Intronic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1136556576 16:31010708-31010730 AGCGGGAGCGCGCAAGGAGCAGG + Intergenic
1136872955 16:33824894-33824916 AGCCGGTGGGAGCCAGGAGCAGG - Intergenic
1136957517 16:34803295-34803317 AGCCGGGGCGGGCAAAAAGCTGG - Intergenic
1203099216 16_KI270728v1_random:1291160-1291182 AGCCGGTGGGAGCCAGGAGCAGG + Intergenic
1142811775 17:2398979-2399001 AGCGGCAGCGGGCAAGGGGCGGG - Intronic
1143750128 17:9021727-9021749 GGCCGCGCCGGGCATGGAGCTGG + Intronic
1145693276 17:26766401-26766423 AGCCGCGGCGGGCAAAAAGTCGG - Intergenic
1150069439 17:62139011-62139033 TGCCGCGGCAAGCAAGGCTCGGG + Intergenic
1150150952 17:62808375-62808397 AGCCGCCGAGAGCACGGGGCGGG + Intergenic
1151791406 17:76308048-76308070 AGGCGCGGCGTGCAGTGAGCGGG - Intergenic
1151812597 17:76453178-76453200 AGCGGCGGCGAACGAGGCGCGGG + Exonic
1152644120 17:81460990-81461012 GGCAGCGGCCAGCAAGGGGCCGG + Exonic
1152853402 17:82649983-82650005 AGCCATGGGGAGGAAGGAGCTGG + Intergenic
1153872619 18:9334720-9334742 AGGGGCGGGGAGCAAGGAGCCGG + Intergenic
1157755269 18:50211951-50211973 AGGAGTGGCGAGCCAGGAGCTGG - Intergenic
1160810384 19:1010632-1010654 TGCCGCGGCCACCAGGGAGCTGG + Exonic
1162148808 19:8630715-8630737 AGCCAGGAGGAGCAAGGAGCAGG + Intergenic
1162396453 19:10420442-10420464 AGCCGCGGCGGGCGGGGGGCGGG + Intronic
1162861056 19:13506124-13506146 AGCGGAGGCGGGCGAGGAGCCGG - Exonic
1162950644 19:14070357-14070379 GGACGCGGCGACCAAGGAGGAGG - Intergenic
1163318116 19:16555346-16555368 AGCCGCTGACAGCCAGGAGCAGG + Exonic
1163444371 19:17338164-17338186 TGGCGTGGCGAGCAAGGGGCAGG - Exonic
1165758927 19:38309416-38309438 GGCCGCGCAGGGCAAGGAGCTGG - Exonic
1166097364 19:40549263-40549285 GGAGCCGGCGAGCAAGGAGCTGG + Exonic
1167671306 19:50855241-50855263 AGCAGCTGGGAGCAGGGAGCTGG - Intronic
1167843378 19:52139996-52140018 AGCCGCGACCAGCAAGGGGCGGG + Intergenic
925237744 2:2293889-2293911 AGGCGCGCCAAGCACGGAGCAGG - Intronic
925419953 2:3703721-3703743 GGCCCCGGCGAGCGAGGAGCGGG + Exonic
927964777 2:27262250-27262272 GGGGGCGGCGAGGAAGGAGCAGG - Intronic
934261406 2:91478885-91478907 AGCCGGGTCGAGCAAAAAGCCGG - Intergenic
934751561 2:96797293-96797315 GGCCGGGGTGAGCAGGGAGCAGG + Intronic
937221907 2:120346688-120346710 AGCCGGAGCTAGCAAGGAGAGGG - Intronic
938092007 2:128440477-128440499 GGCCCCAGTGAGCAAGGAGCGGG + Intergenic
947117944 2:226791674-226791696 AGCCGCGGCGGGCGCGGGGCGGG - Intronic
947217923 2:227766527-227766549 AGCCCAGGCCAGCCAGGAGCCGG + Intergenic
947641154 2:231708570-231708592 GGCTGCGGCGAGCAAGGAGGCGG - Exonic
948772311 2:240257992-240258014 GGCGGCGGAGAGCCAGGAGCGGG + Intergenic
949050576 2:241895475-241895497 AGCCGCCGTGAGAGAGGAGCTGG - Intronic
1169143556 20:3238931-3238953 AGCCGCGGGGAGGAGGGCGCGGG - Intronic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1172913707 20:38428718-38428740 AGCAGCGTCCAGCAAGCAGCTGG + Intergenic
1173309985 20:41888713-41888735 AGAAGGGGCGAGCCAGGAGCAGG + Intergenic
1175929564 20:62487349-62487371 AGCCGCGGGGAGGGAGGAGTGGG + Intergenic
1176029922 20:63006938-63006960 AGCCGCGACGCGCAGGGGGCGGG + Exonic
1176586747 21:8595232-8595254 AGCCGCGGCGGGCAAAAAGCCGG - Intergenic
1180870578 22:19144532-19144554 GGCTGCGACGAGCAAGCAGCGGG - Exonic
1181088557 22:20456672-20456694 AGAAGCTGAGAGCAAGGAGCAGG + Intronic
952529544 3:34249159-34249181 AGCAGCGGGGAGCAAAGAACTGG - Intergenic
953881483 3:46693516-46693538 TGCCGCCGGGACCAAGGAGCTGG + Intronic
958959160 3:100492544-100492566 AGCTGCGGCCACCAATGAGCTGG + Intergenic
960966719 3:123110751-123110773 AGCCGCGGCAGGCCAGGAGCTGG - Intronic
966762291 3:183428712-183428734 AGCCGCGGAGAGAAGGGGGCTGG + Intronic
968258190 3:197297998-197298020 GGCCGCGGCGAGCGAGGAGGCGG - Intronic
969361208 4:6664810-6664832 AGCCGCTGGGCGCAGGGAGCGGG - Intergenic
969413040 4:7042383-7042405 CGGCGCGGAGAGCAAGGAGAGGG - Exonic
973224555 4:47768070-47768092 AGCCGGGGTGAGCCAGGAGAAGG - Intronic
978248692 4:106604835-106604857 AGCCGGCGAGAGCCAGGAGCAGG - Intergenic
980130015 4:128809785-128809807 GGCCGCGGCGGGCGGGGAGCCGG - Exonic
996055052 5:118973605-118973627 GGCTGCCGCGAGCAAGGAGGCGG - Intronic
999768170 5:154756040-154756062 GGCGGCGGCGAGCCAGGCGCTGG + Intronic
1001191546 5:169637199-169637221 AGCCCCGGCGAGGGAGGAGAGGG + Intergenic
1004106705 6:12672763-12672785 AGCCGGGGTGAGCCAGGAGAAGG - Intergenic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005475615 6:26204749-26204771 CCCCGCGACGAGCAAGGCGCCGG - Exonic
1005484327 6:26285373-26285395 CGCCGCGACGAGCAAGGCGCCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006752567 6:36387816-36387838 CGCCGCTGCGGGCTAGGAGCAGG + Intergenic
1007521375 6:42453308-42453330 AGCAGCTGCGAGCAGGGGGCAGG + Intergenic
1007625408 6:43243687-43243709 AGCCGCAGCGGGCACAGAGCAGG + Exonic
1008932374 6:56954573-56954595 AGCCGCGGCGATCATGGTGCGGG + Intronic
1012475729 6:99613581-99613603 AGCAGCAGCAAGCAAGGAGCCGG + Exonic
1012752868 6:103184889-103184911 AGGAGCAGCCAGCAAGGAGCTGG + Intergenic
1018941036 6:168308908-168308930 AGCCACGGCGTGCAGGGGGCTGG + Exonic
1019343481 7:519122-519144 TGGCGCGGGGAGCACGGAGCTGG + Exonic
1019621948 7:1996701-1996723 TGCCCCTGGGAGCAAGGAGCAGG + Intronic
1024024426 7:45399205-45399227 AGCCGGGGGGAGCCAGGAACAGG + Intergenic
1026045636 7:66903949-66903971 GGCCGCGGCGAGGCACGAGCCGG - Intergenic
1026045673 7:66904076-66904098 CGCAGCCACGAGCAAGGAGCTGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1029054925 7:97732203-97732225 AGCCGCGGCCAGCACCGCGCGGG - Intronic
1030593811 7:111511814-111511836 AGCAGGGCCCAGCAAGGAGCTGG + Intronic
1033869300 7:145730694-145730716 AGCCCTGGGGAGCAAGGAGAGGG + Intergenic
1034951023 7:155297451-155297473 AGGCGAGGGGAGCCAGGAGCCGG + Intergenic
1038273264 8:26094865-26094887 AGCCCCGGAGAGCATGGACCTGG - Intergenic
1038383909 8:27122768-27122790 AGCCCGGGCTAGCAAGCAGCGGG - Intergenic
1039068782 8:33632008-33632030 GGCGGCGTGGAGCAAGGAGCGGG - Intergenic
1040077093 8:43247140-43247162 AGCCGCGGCGGCTCAGGAGCGGG + Intergenic
1043428424 8:80171418-80171440 GACCGCGGCGAGCAAGGTGAGGG - Intronic
1045547371 8:103140803-103140825 AGCCCCGGCCCGCAAGGAGGCGG - Exonic
1047514218 8:125539510-125539532 AGCCTCTGCCATCAAGGAGCTGG - Intergenic
1049156858 8:141072718-141072740 AGCCCCGGCGAGCAAGGCCTGGG + Intergenic
1049349006 8:142154129-142154151 GGCCCCGGAAAGCAAGGAGCTGG - Intergenic
1049416986 8:142499778-142499800 AGCGGGGGCGTGCAAGGAGAGGG + Intronic
1049620730 8:143597359-143597381 GGACGCGGCGACCAAGGAGGAGG + Exonic
1049693850 8:143974200-143974222 AGCCCCGGCGCGGAAGGTGCTGG + Intronic
1049709441 8:144057031-144057053 AGGCGCGTAGAGCAGGGAGCAGG + Exonic
1052872845 9:33524441-33524463 AGCCGCGGCGTCTCAGGAGCGGG + Exonic
1057152872 9:92809616-92809638 AGCCGCGGCGGCTCAGGAGCGGG + Intergenic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1061719524 9:132543076-132543098 AGCGGCAGCCAGCAAGGTGCAGG - Intronic
1062084437 9:134641599-134641621 AGTCGCAGCGAGGAAGGGGCTGG - Intergenic
1062493840 9:136822295-136822317 AGCAGAGGCAACCAAGGAGCAGG - Intronic
1062732831 9:138119235-138119257 AGGCGAGCCCAGCAAGGAGCTGG - Intronic
1203616555 Un_KI270749v1:72382-72404 AGCCGCGGCGGGCAAAAAGCCGG - Intergenic
1185778768 X:2828723-2828745 GGCCGCGGCGGGCGAGGGGCGGG + Intergenic
1186496500 X:10015710-10015732 GGCGGCGGCGCGGAAGGAGCTGG - Exonic
1188302606 X:28524228-28524250 AGCTGAGGGGAGTAAGGAGCAGG + Intergenic
1191797368 X:65035120-65035142 AGCCGGGGCCAGAGAGGAGCTGG - Intergenic
1195346458 X:103954821-103954843 AGCTGTGGGGAGCAGGGAGCAGG - Intronic
1195360990 X:104084015-104084037 AGCTGTGGGGAGCAGGGAGCAGG + Intergenic
1200986006 Y:9304039-9304061 AGCCCCTGCCAACAAGGAGCGGG - Intergenic