ID: 1057359734

View in Genome Browser
Species Human (GRCh38)
Location 9:94362133-94362155
Sequence CAGTAGGCCCCGGACTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057359729_1057359734 6 Left 1057359729 9:94362104-94362126 CCTGGAGGGATGAAGAGGACAAG No data
Right 1057359734 9:94362133-94362155 CAGTAGGCCCCGGACTGCCCTGG No data
1057359724_1057359734 24 Left 1057359724 9:94362086-94362108 CCACACATTTTAAAAAGACCTGG No data
Right 1057359734 9:94362133-94362155 CAGTAGGCCCCGGACTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057359734 Original CRISPR CAGTAGGCCCCGGACTGCCC TGG Intergenic
No off target data available for this crispr