ID: 1057361125

View in Genome Browser
Species Human (GRCh38)
Location 9:94374676-94374698
Sequence GGCGCCAGCGGCGGCGCCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1817
Summary {0: 1, 1: 0, 2: 4, 3: 118, 4: 1694}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057361125_1057361139 21 Left 1057361125 9:94374676-94374698 CCCTCGGCGCCGCCGCTGGCGCC 0: 1
1: 0
2: 4
3: 118
4: 1694
Right 1057361139 9:94374720-94374742 CGCGGGCCGCAGAGCCCATGAGG 0: 2
1: 0
2: 0
3: 13
4: 99
1057361125_1057361129 -6 Left 1057361125 9:94374676-94374698 CCCTCGGCGCCGCCGCTGGCGCC 0: 1
1: 0
2: 4
3: 118
4: 1694
Right 1057361129 9:94374693-94374715 GGCGCCGCCGCCTGACCCGCAGG 0: 2
1: 0
2: 3
3: 20
4: 240
1057361125_1057361142 27 Left 1057361125 9:94374676-94374698 CCCTCGGCGCCGCCGCTGGCGCC 0: 1
1: 0
2: 4
3: 118
4: 1694
Right 1057361142 9:94374726-94374748 CCGCAGAGCCCATGAGGGCGCGG 0: 2
1: 0
2: 0
3: 17
4: 187
1057361125_1057361132 3 Left 1057361125 9:94374676-94374698 CCCTCGGCGCCGCCGCTGGCGCC 0: 1
1: 0
2: 4
3: 118
4: 1694
Right 1057361132 9:94374702-94374724 GCCTGACCCGCAGGCCGCCGCGG 0: 2
1: 0
2: 1
3: 13
4: 142
1057361125_1057361134 4 Left 1057361125 9:94374676-94374698 CCCTCGGCGCCGCCGCTGGCGCC 0: 1
1: 0
2: 4
3: 118
4: 1694
Right 1057361134 9:94374703-94374725 CCTGACCCGCAGGCCGCCGCGGG 0: 2
1: 0
2: 2
3: 20
4: 163
1057361125_1057361143 28 Left 1057361125 9:94374676-94374698 CCCTCGGCGCCGCCGCTGGCGCC 0: 1
1: 0
2: 4
3: 118
4: 1694
Right 1057361143 9:94374727-94374749 CGCAGAGCCCATGAGGGCGCGGG 0: 2
1: 0
2: 0
3: 15
4: 144
1057361125_1057361140 22 Left 1057361125 9:94374676-94374698 CCCTCGGCGCCGCCGCTGGCGCC 0: 1
1: 0
2: 4
3: 118
4: 1694
Right 1057361140 9:94374721-94374743 GCGGGCCGCAGAGCCCATGAGGG 0: 2
1: 0
2: 0
3: 17
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057361125 Original CRISPR GGCGCCAGCGGCGGCGCCGA GGG (reversed) Exonic